Incidental Mutation 'R4707:Chrd'
ID355377
Institutional Source Beutler Lab
Gene Symbol Chrd
Ensembl Gene ENSMUSG00000006958
Gene Namechordin
SynonymsChd
MMRRC Submission 041955-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4707 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20733127-20742384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20738808 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 726 (I726F)
Ref Sequence ENSEMBL: ENSMUSP00000007171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000115423] [ENSMUST00000115437] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000231698] [ENSMUST00000232646]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007171
AA Change: I726F

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958
AA Change: I726F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115423
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115437
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151150
Predicted Effect probably benign
Transcript: ENSMUST00000153299
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231689
Predicted Effect probably benign
Transcript: ENSMUST00000231698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232104
Predicted Effect possibly damaging
Transcript: ENSMUST00000232646
AA Change: I748F

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation show some death prior to embryonic day 8.5, but most die perinatally with abnormalities of the skull, malformations of cervical and thoracic vertebrae, cardiovascular defects, and absence of parathyroid and thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,712 K450R probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Abcf3 A G 16: 20,549,058 K56E possibly damaging Het
Acaca T C 11: 84,312,854 V1477A probably damaging Het
Adamts20 G A 15: 94,333,647 P887L possibly damaging Het
Ahnak T G 19: 9,016,735 S5128A probably benign Het
Ahsa2 C A 11: 23,493,162 V197F probably benign Het
Ak9 C A 10: 41,345,460 H402N probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Ankrd16 A G 2: 11,778,797 D70G probably damaging Het
Apob A T 12: 8,006,205 K1562N probably damaging Het
Arfgap2 C A 2: 91,269,971 S250R probably damaging Het
Arhgef10l C T 4: 140,536,883 M671I possibly damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B4galnt2 C T 11: 95,876,097 probably null Het
C8a A G 4: 104,856,421 Y171H probably damaging Het
Cacnb4 A G 2: 52,474,915 V112A probably benign Het
Capn9 G T 8: 124,613,456 C566F possibly damaging Het
Ccdc88a T A 11: 29,447,956 S230T probably benign Het
Cd300c2 A T 11: 114,996,985 F197Y probably benign Het
Chd5 A G 4: 152,360,582 Y340C probably damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clasp1 T A 1: 118,543,197 Y197* probably null Het
Cyp2c69 C G 19: 39,849,408 G410A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Dnah5 A T 15: 28,372,375 D2924V probably damaging Het
Efcab12 A T 6: 115,814,549 L554Q possibly damaging Het
Emsy T C 7: 98,597,104 T228A possibly damaging Het
Evc2 G A 5: 37,421,860 V1106I probably benign Het
Exoc8 G T 8: 124,897,470 Q53K possibly damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fbn2 A T 18: 58,056,272 V1594D probably damaging Het
Fer1l4 T C 2: 156,045,623 Y551C possibly damaging Het
Fmnl3 A G 15: 99,323,481 M481T probably benign Het
Fras1 A G 5: 96,735,238 N2543S probably damaging Het
Fsd2 T C 7: 81,559,680 D138G probably damaging Het
Gda C T 19: 21,428,628 V5I probably benign Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Greb1l A G 18: 10,532,922 M830V probably benign Het
Hnrnpul1 A C 7: 25,726,833 V531G probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Igsf3 G C 3: 101,458,094 R1127P probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Islr T C 9: 58,157,687 D179G possibly damaging Het
Jcad G T 18: 4,649,338 E70* probably null Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Mbd5 T C 2: 49,250,156 L44S probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Mgam A T 6: 40,714,632 probably null Het
Mipep T A 14: 60,872,103 I643N probably damaging Het
Mmrn1 A T 6: 60,988,473 I1162L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mug1 G A 6: 121,884,641 C1354Y probably damaging Het
Nbeal2 A T 9: 110,632,055 S1647T probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nedd9 A T 13: 41,338,575 probably null Het
Nr4a2 T A 2: 57,112,093 H116L probably benign Het
Nwd2 A G 5: 63,794,322 Y232C probably damaging Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1197 T A 2: 88,728,712 M296L possibly damaging Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr1284 T A 2: 111,379,645 L215H probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr434 T A 6: 43,216,949 V12D probably benign Het
Olfr58 C T 9: 19,783,300 H18Y probably damaging Het
Olfr938 A G 9: 39,078,262 V161A probably benign Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Prdx6b T C 2: 80,293,060 L71P probably damaging Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptdss1 T C 13: 66,995,418 probably null Het
Pygl T C 12: 70,207,758 T138A possibly damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rev3l T A 10: 39,823,397 S1297T probably damaging Het
Rgma C A 7: 73,417,816 T367K probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rslcan18 A T 13: 67,098,526 C217S probably damaging Het
Rtp3 A G 9: 110,986,211 probably benign Het
Ryr1 A T 7: 29,045,662 N3848K probably damaging Het
Sema6a T A 18: 47,248,712 T923S probably benign Het
Serpinb6d A T 13: 33,671,353 T337S possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sidt1 A T 16: 44,269,858 Y369* probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a17 A C 15: 81,327,326 L163W probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sptbn1 T C 11: 30,137,197 T1081A possibly damaging Het
Sptbn4 T C 7: 27,417,006 D456G probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r118 T A 6: 23,969,226 M279L probably benign Het
Tc2n T G 12: 101,694,573 Q133H probably benign Het
Tctn1 A G 5: 122,261,405 probably null Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tex10 A T 4: 48,468,984 S64T probably benign Het
Tex15 A G 8: 33,582,497 T2691A probably benign Het
Tmem175 A T 5: 108,642,150 T123S probably damaging Het
Tsc1 C A 2: 28,672,407 S348R probably damaging Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttll8 A T 15: 88,917,090 I465N probably damaging Het
Ubr3 A G 2: 69,938,370 probably benign Het
Ugdh A T 5: 65,423,352 probably null Het
Usp34 T C 11: 23,487,215 L3326S probably damaging Het
Vmn2r125 A T 4: 156,349,981 I21F probably damaging Het
Vps9d1 G A 8: 123,248,612 probably benign Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zbtb12 T C 17: 34,895,499 S87P probably damaging Het
Zc3h12a A G 4: 125,120,893 M266T probably damaging Het
Zfp108 G A 7: 24,260,412 A143T probably benign Het
Other mutations in Chrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Chrd APN 16 20741225 missense possibly damaging 0.89
IGL01486:Chrd APN 16 20734140 splice site probably null
IGL02120:Chrd APN 16 20734541 missense probably damaging 1.00
IGL02370:Chrd APN 16 20735791 missense possibly damaging 0.52
IGL02675:Chrd APN 16 20739949 splice site probably benign
IGL02678:Chrd APN 16 20734020 missense probably damaging 1.00
IGL02874:Chrd APN 16 20735196 missense probably damaging 1.00
ANU74:Chrd UTSW 16 20741319 missense possibly damaging 0.88
PIT1430001:Chrd UTSW 16 20738998 critical splice donor site probably null
R0016:Chrd UTSW 16 20734308 missense possibly damaging 0.85
R0230:Chrd UTSW 16 20733275 missense probably benign 0.25
R0605:Chrd UTSW 16 20735439 missense probably damaging 1.00
R0831:Chrd UTSW 16 20741309 missense probably damaging 0.99
R1501:Chrd UTSW 16 20737533 missense probably damaging 1.00
R1659:Chrd UTSW 16 20735831 missense probably damaging 0.96
R1766:Chrd UTSW 16 20737441 missense probably damaging 1.00
R1823:Chrd UTSW 16 20741347 splice site probably benign
R3001:Chrd UTSW 16 20737445 nonsense probably null
R3002:Chrd UTSW 16 20737445 nonsense probably null
R3874:Chrd UTSW 16 20738910 missense probably damaging 0.99
R4319:Chrd UTSW 16 20737048 missense probably damaging 0.99
R4587:Chrd UTSW 16 20738575 missense possibly damaging 0.58
R4857:Chrd UTSW 16 20738758 missense possibly damaging 0.79
R5204:Chrd UTSW 16 20736072 missense probably benign 0.02
R5364:Chrd UTSW 16 20733148 start codon destroyed probably null 0.03
R5445:Chrd UTSW 16 20738910 missense possibly damaging 0.74
R5611:Chrd UTSW 16 20738974 missense probably damaging 1.00
R5940:Chrd UTSW 16 20734586 missense probably null 0.01
R6004:Chrd UTSW 16 20735237 missense possibly damaging 0.92
R6767:Chrd UTSW 16 20738626 missense probably benign 0.00
R6798:Chrd UTSW 16 20734306 missense probably damaging 1.00
R6801:Chrd UTSW 16 20735747 missense possibly damaging 0.68
R6823:Chrd UTSW 16 20734736 missense probably damaging 1.00
R6999:Chrd UTSW 16 20735652 missense probably benign
R7069:Chrd UTSW 16 20739433 missense probably damaging 1.00
R7136:Chrd UTSW 16 20734522 missense possibly damaging 0.82
R7273:Chrd UTSW 16 20741566 missense probably benign 0.32
R7558:Chrd UTSW 16 20738554 missense probably damaging 1.00
X0063:Chrd UTSW 16 20737564 critical splice donor site probably null
Z1088:Chrd UTSW 16 20741255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAAGGAGTGCAGATGCC -3'
(R):5'- GACATTCACCTGGACACACG -3'

Sequencing Primer
(F):5'- AGGAGTGCAGATGCCCTTGG -3'
(R):5'- GACACACGGGACAGCACTG -3'
Posted On2015-10-21