Incidental Mutation 'R4707:Greb1l'
ID355382
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 041955-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4707 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10532922 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 830 (M830V)
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: M939V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: M939V

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
AA Change: M830V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: M830V

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,712 K450R probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Abcf3 A G 16: 20,549,058 K56E possibly damaging Het
Acaca T C 11: 84,312,854 V1477A probably damaging Het
Adamts20 G A 15: 94,333,647 P887L possibly damaging Het
Ahnak T G 19: 9,016,735 S5128A probably benign Het
Ahsa2 C A 11: 23,493,162 V197F probably benign Het
Ak9 C A 10: 41,345,460 H402N probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Ankrd16 A G 2: 11,778,797 D70G probably damaging Het
Apob A T 12: 8,006,205 K1562N probably damaging Het
Arfgap2 C A 2: 91,269,971 S250R probably damaging Het
Arhgef10l C T 4: 140,536,883 M671I possibly damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B4galnt2 C T 11: 95,876,097 probably null Het
C8a A G 4: 104,856,421 Y171H probably damaging Het
Cacnb4 A G 2: 52,474,915 V112A probably benign Het
Capn9 G T 8: 124,613,456 C566F possibly damaging Het
Ccdc88a T A 11: 29,447,956 S230T probably benign Het
Cd300c2 A T 11: 114,996,985 F197Y probably benign Het
Chd5 A G 4: 152,360,582 Y340C probably damaging Het
Chrd A T 16: 20,738,808 I726F possibly damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clasp1 T A 1: 118,543,197 Y197* probably null Het
Cyp2c69 C G 19: 39,849,408 G410A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Dnah5 A T 15: 28,372,375 D2924V probably damaging Het
Efcab12 A T 6: 115,814,549 L554Q possibly damaging Het
Emsy T C 7: 98,597,104 T228A possibly damaging Het
Evc2 G A 5: 37,421,860 V1106I probably benign Het
Exoc8 G T 8: 124,897,470 Q53K possibly damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fbn2 A T 18: 58,056,272 V1594D probably damaging Het
Fer1l4 T C 2: 156,045,623 Y551C possibly damaging Het
Fmnl3 A G 15: 99,323,481 M481T probably benign Het
Fras1 A G 5: 96,735,238 N2543S probably damaging Het
Fsd2 T C 7: 81,559,680 D138G probably damaging Het
Gda C T 19: 21,428,628 V5I probably benign Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Hnrnpul1 A C 7: 25,726,833 V531G probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Igsf3 G C 3: 101,458,094 R1127P probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Islr T C 9: 58,157,687 D179G possibly damaging Het
Jcad G T 18: 4,649,338 E70* probably null Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Mbd5 T C 2: 49,250,156 L44S probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Mgam A T 6: 40,714,632 probably null Het
Mipep T A 14: 60,872,103 I643N probably damaging Het
Mmrn1 A T 6: 60,988,473 I1162L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mug1 G A 6: 121,884,641 C1354Y probably damaging Het
Nbeal2 A T 9: 110,632,055 S1647T probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nedd9 A T 13: 41,338,575 probably null Het
Nr4a2 T A 2: 57,112,093 H116L probably benign Het
Nwd2 A G 5: 63,794,322 Y232C probably damaging Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1197 T A 2: 88,728,712 M296L possibly damaging Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr1284 T A 2: 111,379,645 L215H probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr434 T A 6: 43,216,949 V12D probably benign Het
Olfr58 C T 9: 19,783,300 H18Y probably damaging Het
Olfr938 A G 9: 39,078,262 V161A probably benign Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Prdx6b T C 2: 80,293,060 L71P probably damaging Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptdss1 T C 13: 66,995,418 probably null Het
Pygl T C 12: 70,207,758 T138A possibly damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rev3l T A 10: 39,823,397 S1297T probably damaging Het
Rgma C A 7: 73,417,816 T367K probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rslcan18 A T 13: 67,098,526 C217S probably damaging Het
Rtp3 A G 9: 110,986,211 probably benign Het
Ryr1 A T 7: 29,045,662 N3848K probably damaging Het
Sema6a T A 18: 47,248,712 T923S probably benign Het
Serpinb6d A T 13: 33,671,353 T337S possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sidt1 A T 16: 44,269,858 Y369* probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a17 A C 15: 81,327,326 L163W probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sptbn1 T C 11: 30,137,197 T1081A possibly damaging Het
Sptbn4 T C 7: 27,417,006 D456G probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r118 T A 6: 23,969,226 M279L probably benign Het
Tc2n T G 12: 101,694,573 Q133H probably benign Het
Tctn1 A G 5: 122,261,405 probably null Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tex10 A T 4: 48,468,984 S64T probably benign Het
Tex15 A G 8: 33,582,497 T2691A probably benign Het
Tmem175 A T 5: 108,642,150 T123S probably damaging Het
Tsc1 C A 2: 28,672,407 S348R probably damaging Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttll8 A T 15: 88,917,090 I465N probably damaging Het
Ubr3 A G 2: 69,938,370 probably benign Het
Ugdh A T 5: 65,423,352 probably null Het
Usp34 T C 11: 23,487,215 L3326S probably damaging Het
Vmn2r125 A T 4: 156,349,981 I21F probably damaging Het
Vps9d1 G A 8: 123,248,612 probably benign Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zbtb12 T C 17: 34,895,499 S87P probably damaging Het
Zc3h12a A G 4: 125,120,893 M266T probably damaging Het
Zfp108 G A 7: 24,260,412 A143T probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCTGCTGAGCGCTAAC -3'
(R):5'- AACGAAACAAACGGTGTGCC -3'

Sequencing Primer
(F):5'- TGCTGAGCGCTAACTCCCTG -3'
(R):5'- GCTAACCTTTAGTCGGGTTACAAAG -3'
Posted On2015-10-21