Incidental Mutation 'R4708:2610021A01Rik'
ID355412
Institutional Source Beutler Lab
Gene Symbol 2610021A01Rik
Ensembl Gene ENSMUSG00000091474
Gene NameRIKEN cDNA 2610021A01 gene
Synonyms
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41599230-41628533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41611885 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 2 (G2D)
Ref Sequence ENSEMBL: ENSMUSP00000146223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163475] [ENSMUST00000205433]
Predicted Effect probably damaging
Transcript: ENSMUST00000163475
AA Change: G2D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127760
Gene: ENSMUSG00000091474
AA Change: G2D

DomainStartEndE-ValueType
KRAB 18 78 1.32e-32 SMART
ZnF_C2H2 415 437 4.54e-4 SMART
ZnF_C2H2 443 465 3.69e-4 SMART
ZnF_C2H2 471 493 5.14e-3 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 3.16e-3 SMART
ZnF_C2H2 555 577 3.16e-3 SMART
ZnF_C2H2 583 605 8.6e-5 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.43e-4 SMART
ZnF_C2H2 667 689 1.72e-4 SMART
ZnF_C2H2 695 717 9.73e-4 SMART
ZnF_C2H2 723 745 2.02e-1 SMART
ZnF_C2H2 751 773 1.69e-3 SMART
ZnF_C2H2 779 801 3.69e-4 SMART
ZnF_C2H2 807 829 7.37e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205433
AA Change: G2D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206985
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in 2610021A01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:2610021A01Rik APN 7 41625572 missense possibly damaging 0.61
IGL00566:2610021A01Rik APN 7 41625391 missense possibly damaging 0.53
R0940:2610021A01Rik UTSW 7 41626434 missense probably damaging 1.00
R1101:2610021A01Rik UTSW 7 41627359 missense probably damaging 1.00
R1180:2610021A01Rik UTSW 7 41625717 missense probably benign 0.41
R1560:2610021A01Rik UTSW 7 41626042 missense probably benign 0.09
R1740:2610021A01Rik UTSW 7 41626125 nonsense probably null
R1988:2610021A01Rik UTSW 7 41626657 nonsense probably null
R2041:2610021A01Rik UTSW 7 41625979 missense possibly damaging 0.63
R2964:2610021A01Rik UTSW 7 41626405 nonsense probably null
R2965:2610021A01Rik UTSW 7 41626405 nonsense probably null
R2966:2610021A01Rik UTSW 7 41626405 nonsense probably null
R4002:2610021A01Rik UTSW 7 41625540 missense possibly damaging 0.83
R4569:2610021A01Rik UTSW 7 41625838 missense probably benign 0.04
R4880:2610021A01Rik UTSW 7 41627105 missense possibly damaging 0.47
R4933:2610021A01Rik UTSW 7 41626802 missense probably damaging 0.98
R5036:2610021A01Rik UTSW 7 41626154 missense possibly damaging 0.92
R5206:2610021A01Rik UTSW 7 41626585 nonsense probably null
R5235:2610021A01Rik UTSW 7 41624832 missense possibly damaging 0.53
R6449:2610021A01Rik UTSW 7 41625874 nonsense probably null
R6488:2610021A01Rik UTSW 7 41625874 nonsense probably null
R6904:2610021A01Rik UTSW 7 41626092 nonsense probably null
R7058:2610021A01Rik UTSW 7 41626130 missense possibly damaging 0.61
R7157:2610021A01Rik UTSW 7 41626976 missense probably damaging 1.00
R7392:2610021A01Rik UTSW 7 41626566 missense probably damaging 1.00
R7589:2610021A01Rik UTSW 7 41626972 missense probably damaging 1.00
R7648:2610021A01Rik UTSW 7 41612462 missense possibly damaging 0.51
R7785:2610021A01Rik UTSW 7 41613193 missense probably benign
X0067:2610021A01Rik UTSW 7 41627317 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGCTGTGCCCTTATGTGCC -3'
(R):5'- GGCTTGTAAATATTTCAGGCCATG -3'

Sequencing Primer
(F):5'- TGCCCTTATGTGCCTGATG -3'
(R):5'- CAGGCCATGCATTCCTGGAAAG -3'
Posted On2015-10-21