Incidental Mutation 'R4708:Zfp560'
ID355422
Institutional Source Beutler Lab
Gene Symbol Zfp560
Ensembl Gene ENSMUSG00000045519
Gene Namezinc finger protein 560
Synonyms
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20345136-20385177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20351918 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 54 (E54G)
Ref Sequence ENSEMBL: ENSMUSP00000065620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068079] [ENSMUST00000143992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068079
AA Change: E54G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065620
Gene: ENSMUSG00000045519
AA Change: E54G

DomainStartEndE-ValueType
KRAB 41 101 3.22e-27 SMART
low complexity region 147 158 N/A INTRINSIC
ZnF_C2H2 279 301 4.01e-5 SMART
ZnF_C2H2 307 329 9.58e-3 SMART
ZnF_C2H2 335 357 5.5e-3 SMART
ZnF_C2H2 363 385 9.58e-3 SMART
ZnF_C2H2 391 413 3.74e-5 SMART
ZnF_C2H2 419 441 2.43e-4 SMART
ZnF_C2H2 447 469 1.28e-3 SMART
ZnF_C2H2 475 497 1.06e-4 SMART
ZnF_C2H2 503 525 3.11e-2 SMART
ZnF_C2H2 531 553 8.47e-4 SMART
ZnF_C2H2 559 581 2.99e-4 SMART
ZnF_C2H2 587 609 4.24e-4 SMART
ZnF_C2H2 615 637 3.44e-4 SMART
ZnF_C2H2 643 665 1.26e-2 SMART
ZnF_C2H2 671 693 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214965
Meta Mutation Damage Score 0.5501 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Zfp560
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Zfp560 APN 9 20348808 missense probably benign 0.00
IGL02400:Zfp560 APN 9 20350600 missense possibly damaging 0.73
R0002:Zfp560 UTSW 9 20347517 missense probably damaging 1.00
R0004:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R0019:Zfp560 UTSW 9 20348360 missense probably benign 0.23
R1401:Zfp560 UTSW 9 20351853 missense possibly damaging 0.71
R1481:Zfp560 UTSW 9 20348790 missense probably benign
R1521:Zfp560 UTSW 9 20348775 unclassified probably null
R1569:Zfp560 UTSW 9 20348715 missense possibly damaging 0.83
R1579:Zfp560 UTSW 9 20347991 missense possibly damaging 0.73
R1673:Zfp560 UTSW 9 20347653 missense probably benign 0.37
R1694:Zfp560 UTSW 9 20347986 nonsense probably null
R1796:Zfp560 UTSW 9 20351930 missense possibly damaging 0.71
R2971:Zfp560 UTSW 9 20348944 missense probably benign 0.00
R3416:Zfp560 UTSW 9 20347678 nonsense probably null
R4182:Zfp560 UTSW 9 20347448 missense probably benign 0.11
R4509:Zfp560 UTSW 9 20348723 missense probably damaging 1.00
R4735:Zfp560 UTSW 9 20349051 missense probably benign 0.01
R4937:Zfp560 UTSW 9 20347967 missense probably damaging 1.00
R5562:Zfp560 UTSW 9 20350587 nonsense probably null
R6597:Zfp560 UTSW 9 20348001 missense probably benign 0.00
R6852:Zfp560 UTSW 9 20348043 missense probably damaging 0.99
R6863:Zfp560 UTSW 9 20348499 missense probably damaging 0.99
R7267:Zfp560 UTSW 9 20348088 missense probably damaging 0.96
R7619:Zfp560 UTSW 9 20348910 missense probably benign 0.01
R7763:Zfp560 UTSW 9 20347323 missense possibly damaging 0.96
R8220:Zfp560 UTSW 9 20349052 missense probably benign 0.00
Z1176:Zfp560 UTSW 9 20347704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTAGAGCTGCTATCACAAATC -3'
(R):5'- TATTCGCTGAACTCTGCCGTAG -3'

Sequencing Primer
(F):5'- TGAGAGATGACTCCCAAAAGTTGTCC -3'
(R):5'- TAGGCTGCTAGAGAACTCCC -3'
Posted On2015-10-21