Incidental Mutation 'R4708:Cep290'
ID355429
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100523264 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 952 (K952R)
Ref Sequence ENSEMBL: ENSMUSP00000151388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: K952R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: K952R

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: K945R

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: K952R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 splice site probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7699:Cep290 UTSW 10 100540369 missense probably benign 0.33
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R8078:Cep290 UTSW 10 100572887 missense probably benign 0.04
R8081:Cep290 UTSW 10 100558176 nonsense probably null
R8094:Cep290 UTSW 10 100544931 missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100559671 missense probably benign 0.08
R8305:Cep290 UTSW 10 100544934 missense probably benign 0.09
R8325:Cep290 UTSW 10 100517808 missense probably benign 0.03
R8372:Cep290 UTSW 10 100549341 missense probably benign 0.00
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTGCCAGATGCTTAGTGG -3'
(R):5'- AGGATGCCCTAAAGTAAATGACTGG -3'

Sequencing Primer
(F):5'- GCCAGATGCTTAGTGGATTTTAATC -3'
(R):5'- GCCCTAAAGTAAATGACTGGAATAAC -3'
Posted On2015-10-21