Incidental Mutation 'R4708:Eif4enif1'
ID355432
Institutional Source Beutler Lab
Gene Symbol Eif4enif1
Ensembl Gene ENSMUSG00000020454
Gene Nameeukaryotic translation initiation factor 4E nuclear import factor 1
SynonymsD11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3202392-3244588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3220323 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 125 (H125Q)
Ref Sequence ENSEMBL: ENSMUSP00000136768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000125637] [ENSMUST00000179770]
Predicted Effect probably benign
Transcript: ENSMUST00000020734
AA Change: H125Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454
AA Change: H125Q

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110048
AA Change: H125Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454
AA Change: H125Q

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110049
AA Change: H125Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454
AA Change: H125Q

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 712 2.7e-184 PFAM
low complexity region 859 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120721
SMART Domains Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 99 3.6e-29 PFAM
Pfam:EIF4E-T 98 327 5.1e-41 PFAM
Pfam:EIF4E-T 282 537 7.7e-30 PFAM
low complexity region 684 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125224
Predicted Effect possibly damaging
Transcript: ENSMUST00000125637
AA Change: H125Q

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118527
Gene: ENSMUSG00000020454
AA Change: H125Q

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 194 1.5e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159304
SMART Domains Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

DomainStartEndE-ValueType
Pfam:TGS 13 58 5.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179770
AA Change: H125Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454
AA Change: H125Q

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 710 4.3e-160 PFAM
low complexity region 859 875 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Eif4enif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Eif4enif1 APN 11 3221143 missense probably damaging 0.96
IGL02237:Eif4enif1 APN 11 3227876 nonsense probably null
IGL02372:Eif4enif1 APN 11 3229986 missense probably benign 0.09
PIT4283001:Eif4enif1 UTSW 11 3234464 missense probably damaging 1.00
R0079:Eif4enif1 UTSW 11 3242676 nonsense probably null
R1177:Eif4enif1 UTSW 11 3229902 missense probably damaging 1.00
R1220:Eif4enif1 UTSW 11 3239493 splice site probably benign
R1511:Eif4enif1 UTSW 11 3236278 missense probably benign 0.00
R1675:Eif4enif1 UTSW 11 3215686 missense probably benign 0.02
R1908:Eif4enif1 UTSW 11 3227455 missense probably damaging 1.00
R1940:Eif4enif1 UTSW 11 3243279 missense probably damaging 1.00
R2173:Eif4enif1 UTSW 11 3242367 splice site probably null
R2215:Eif4enif1 UTSW 11 3227476 missense probably damaging 1.00
R2517:Eif4enif1 UTSW 11 3221168 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R2873:Eif4enif1 UTSW 11 3242586 missense probably damaging 1.00
R3147:Eif4enif1 UTSW 11 3244003 unclassified probably null
R4195:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4196:Eif4enif1 UTSW 11 3243186 missense possibly damaging 0.89
R4755:Eif4enif1 UTSW 11 3244016 missense probably damaging 1.00
R5310:Eif4enif1 UTSW 11 3242687 missense probably damaging 1.00
R5546:Eif4enif1 UTSW 11 3243989 missense probably damaging 0.99
R5816:Eif4enif1 UTSW 11 3242401 missense probably benign 0.13
R6018:Eif4enif1 UTSW 11 3242481 missense probably damaging 0.97
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6036:Eif4enif1 UTSW 11 3239420 missense probably damaging 1.00
R6267:Eif4enif1 UTSW 11 3227793 missense probably damaging 1.00
R6514:Eif4enif1 UTSW 11 3240996 missense probably null 0.01
R6638:Eif4enif1 UTSW 11 3242463 missense probably damaging 0.96
R7040:Eif4enif1 UTSW 11 3234040 missense probably benign 0.33
R7232:Eif4enif1 UTSW 11 3215678 missense possibly damaging 0.75
R7385:Eif4enif1 UTSW 11 3220269 missense probably damaging 1.00
R7478:Eif4enif1 UTSW 11 3227709 nonsense probably null
R7749:Eif4enif1 UTSW 11 3242608 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTGAATCTGTTGATGAGCC -3'
(R):5'- GTGCAGTCCTGGTTTTGAAC -3'

Sequencing Primer
(F):5'- CCAGTTGCTGAGGACATGGTATC -3'
(R):5'- TGGCCTCTTTAGACAGACAGAGTAC -3'
Posted On2015-10-21