Incidental Mutation 'R4708:Arhgap27'
ID355436
Institutional Source Beutler Lab
Gene Symbol Arhgap27
Ensembl Gene ENSMUSG00000034255
Gene NameRho GTPase activating protein 27
Synonyms5730442P18Rik, Sh3d20, 2310069I04Rik
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103331497-103363692 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 103333562 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041385] [ENSMUST00000107024]
Predicted Effect probably benign
Transcript: ENSMUST00000041385
SMART Domains Protein: ENSMUSP00000039427
Gene: ENSMUSG00000034255

DomainStartEndE-ValueType
WW 48 81 3.49e-8 SMART
WW 101 134 7.44e-3 SMART
WW 216 248 2.32e-4 SMART
PH 279 396 1.08e-9 SMART
Blast:RhoGAP 446 480 2e-10 BLAST
RhoGAP 489 664 1.45e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107024
SMART Domains Protein: ENSMUSP00000102639
Gene: ENSMUSG00000034255

DomainStartEndE-ValueType
SH3 9 68 1.59e-1 SMART
low complexity region 73 89 N/A INTRINSIC
WW 247 280 3.49e-8 SMART
WW 300 333 7.44e-3 SMART
WW 415 447 2.32e-4 SMART
PH 478 595 1.08e-9 SMART
Blast:RhoGAP 651 682 1e-6 BLAST
RhoGAP 688 863 1.45e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163250
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may pay a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Arhgap27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Arhgap27 APN 11 103333163 missense probably benign 0.00
IGL02946:Arhgap27 APN 11 103338348 missense probably damaging 1.00
IGL03135:Arhgap27 APN 11 103339065 unclassified probably null
R1789:Arhgap27 UTSW 11 103333005 missense probably damaging 1.00
R1842:Arhgap27 UTSW 11 103339996 missense probably damaging 0.99
R1906:Arhgap27 UTSW 11 103332925 missense probably damaging 1.00
R2884:Arhgap27 UTSW 11 103360843 unclassified probably null
R2885:Arhgap27 UTSW 11 103360843 unclassified probably null
R3157:Arhgap27 UTSW 11 103333837 splice site probably null
R4679:Arhgap27 UTSW 11 103360949 unclassified probably benign
R4926:Arhgap27 UTSW 11 103339123 splice site probably null
R5980:Arhgap27 UTSW 11 103356269 missense probably benign 0.00
R6212:Arhgap27 UTSW 11 103360872 missense probably damaging 1.00
R7205:Arhgap27 UTSW 11 103344541 missense probably benign 0.00
R7208:Arhgap27 UTSW 11 103360759 missense probably damaging 1.00
R7212:Arhgap27 UTSW 11 103360755 missense probably damaging 0.99
R7327:Arhgap27 UTSW 11 103360541 nonsense probably null
R7598:Arhgap27 UTSW 11 103334053 nonsense probably null
R7732:Arhgap27 UTSW 11 103340043 missense probably benign 0.00
R7791:Arhgap27 UTSW 11 103339194 critical splice donor site probably null
R7826:Arhgap27 UTSW 11 103338327 missense probably benign
X0028:Arhgap27 UTSW 11 103333028 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TATGAACTGGTGGAAGTGCG -3'
(R):5'- ACCGGCTTTTAGGGAGCTAAG -3'

Sequencing Primer
(F):5'- GGAAGAGAGGTTCCGGCAGC -3'
(R):5'- TATTGATGGGCTGTACCG -3'
Posted On2015-10-21