Incidental Mutation 'R4708:Aco2'
ID355444
Institutional Source Beutler Lab
Gene Symbol Aco2
Ensembl Gene ENSMUSG00000022477
Gene Nameaconitase 2, mitochondrial
SynonymsAco-2, Aco3, D10Wsu183e
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81872309-81915133 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 81909916 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023116] [ENSMUST00000229068]
Predicted Effect probably null
Transcript: ENSMUST00000023116
SMART Domains Protein: ENSMUSP00000023116
Gene: ENSMUSG00000022477

DomainStartEndE-ValueType
Pfam:Aconitase 65 503 2.2e-160 PFAM
Pfam:Aconitase_C 582 712 5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155704
Predicted Effect probably benign
Transcript: ENSMUST00000229068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230669
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Aco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Aco2 APN 15 81913714 missense possibly damaging 0.88
IGL02450:Aco2 APN 15 81914762 makesense probably null
IGL03408:Aco2 APN 15 81899223 critical splice donor site probably null
ANU22:Aco2 UTSW 15 81913714 missense possibly damaging 0.88
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0254:Aco2 UTSW 15 81889356 missense probably damaging 0.99
R0408:Aco2 UTSW 15 81913118 unclassified probably null
R0535:Aco2 UTSW 15 81913217 missense possibly damaging 0.76
R0839:Aco2 UTSW 15 81907535 splice site probably null
R1199:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1201:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1320:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1321:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1322:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R2082:Aco2 UTSW 15 81913695 missense possibly damaging 0.83
R2275:Aco2 UTSW 15 81895264 missense probably benign 0.37
R2297:Aco2 UTSW 15 81903908 missense probably damaging 1.00
R4414:Aco2 UTSW 15 81889383 splice site probably null
R4497:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R4498:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R5556:Aco2 UTSW 15 81889319 missense probably damaging 1.00
R5568:Aco2 UTSW 15 81903586 missense probably damaging 0.99
R6103:Aco2 UTSW 15 81913251 missense probably benign 0.00
R6912:Aco2 UTSW 15 81895396 missense probably benign
R7319:Aco2 UTSW 15 81903619 missense probably damaging 1.00
R7552:Aco2 UTSW 15 81903941 missense probably damaging 1.00
R7585:Aco2 UTSW 15 81872484 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTGGGCTAAGGCAATGCAG -3'
(R):5'- TTGGCTTCTAGGATGCAGCC -3'

Sequencing Primer
(F):5'- GGCATAGCCTTTCATGCTCCAG -3'
(R):5'- GGCTTCTTCCTGTCAGACAG -3'
Posted On2015-10-21