Incidental Mutation 'R4708:Riox2'
ID355446
Institutional Source Beutler Lab
Gene Symbol Riox2
Ensembl Gene ENSMUSG00000022724
Gene Nameribosomal oxygenase 2
Synonyms3830408E23Rik, 1810047J07Rik, Mina, 2410057H13Rik
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59471775-59492461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59475682 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 49 (I49V)
Ref Sequence ENSEMBL: ENSMUSP00000112950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023407] [ENSMUST00000120667] [ENSMUST00000120674] [ENSMUST00000138324] [ENSMUST00000160571]
Predicted Effect probably benign
Transcript: ENSMUST00000023407
AA Change: I49V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023407
Gene: ENSMUSG00000022724
AA Change: I49V

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120667
AA Change: I49V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112950
Gene: ENSMUSG00000022724
AA Change: I49V

DomainStartEndE-ValueType
Pfam:Cupin_4 51 150 7.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120674
AA Change: I49V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112899
Gene: ENSMUSG00000022724
AA Change: I49V

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138324
AA Change: I49V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121743
Gene: ENSMUSG00000022724
AA Change: I49V

DomainStartEndE-ValueType
Pfam:Cupin_4 51 74 5.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160571
AA Change: I49V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125297
Gene: ENSMUSG00000022724
AA Change: I49V

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MINA is a c-Myc (MYC; MIM 190080) target gene that may play a role in cell proliferation or regulation of cell growth. (Tsuneoka et al., 2002 [PubMed 12091391]; Zhang et al., 2005 [PubMed 15897898]).[supplied by OMIM, May 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced allergic response to house dust mites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Riox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Riox2 APN 16 59489417 missense probably benign 0.03
IGL02580:Riox2 APN 16 59486573 missense probably benign 0.00
IGL03076:Riox2 APN 16 59491212 missense possibly damaging 0.68
R0009:Riox2 UTSW 16 59489367 missense probably benign 0.01
R0009:Riox2 UTSW 16 59489367 missense probably benign 0.01
R0322:Riox2 UTSW 16 59489389 nonsense probably null
R0592:Riox2 UTSW 16 59489579 unclassified probably benign
R0620:Riox2 UTSW 16 59491892 missense probably benign 0.20
R1588:Riox2 UTSW 16 59475583 missense possibly damaging 0.46
R1623:Riox2 UTSW 16 59483042 missense probably damaging 1.00
R2863:Riox2 UTSW 16 59489393 missense probably damaging 0.99
R4113:Riox2 UTSW 16 59491894 missense probably benign 0.01
R4468:Riox2 UTSW 16 59475994 intron probably benign
R4739:Riox2 UTSW 16 59489369 missense probably benign
R5074:Riox2 UTSW 16 59491873 missense possibly damaging 0.59
R5385:Riox2 UTSW 16 59486616 missense probably benign 0.33
R8124:Riox2 UTSW 16 59486591 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAACCCGACAGTGTCTTATTCTTC -3'
(R):5'- GAAAATGTGCTCTGCCGTCC -3'

Sequencing Primer
(F):5'- GACAGTGTCTTATTCTTCTCCTAGG -3'
(R):5'- GTGCTCTGCCGTCCTTATTTAAAAC -3'
Posted On2015-10-21