Incidental Mutation 'R4708:Tmx3'
ID355450
Institutional Source Beutler Lab
Gene Symbol Tmx3
Ensembl Gene ENSMUSG00000024614
Gene Namethioredoxin-related transmembrane protein 3
Synonyms6430411B10Rik, A730024F05Rik, Txndc10
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location90510154-90543267 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 90521039 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025515]
Predicted Effect probably null
Transcript: ENSMUST00000025515
SMART Domains Protein: ENSMUSP00000025515
Gene: ENSMUSG00000024614

DomainStartEndE-ValueType
Pfam:Thioredoxin 30 132 3.6e-26 PFAM
Pfam:Thioredoxin_6 160 341 1.6e-27 PFAM
transmembrane domain 377 399 N/A INTRINSIC
low complexity region 418 436 N/A INTRINSIC
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and a C-terminal ER-retention sequence. This gene is expressed in many tissues but has its highest expression in heart and skeletal muscle. It is expressed in the retinal neuroepithelium and lens epithelium in the developing murine eye and haploinsufficiency of this gene in humans and zebrafish is associated with microphthalmia. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Tmx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Tmx3 APN 18 90540054 missense possibly damaging 0.53
IGL01790:Tmx3 APN 18 90511334 critical splice donor site probably null
IGL01888:Tmx3 APN 18 90527921 missense probably benign 0.05
IGL02689:Tmx3 APN 18 90537116 missense possibly damaging 0.70
IGL03212:Tmx3 APN 18 90538518 missense probably damaging 0.98
R0243:Tmx3 UTSW 18 90538489 splice site probably benign
R0255:Tmx3 UTSW 18 90540006 missense probably damaging 0.96
R0981:Tmx3 UTSW 18 90537200 missense probably benign
R1528:Tmx3 UTSW 18 90537086 missense possibly damaging 0.89
R1772:Tmx3 UTSW 18 90532997 missense probably benign
R2144:Tmx3 UTSW 18 90517490 missense probably damaging 1.00
R2155:Tmx3 UTSW 18 90510381 splice site probably null
R2202:Tmx3 UTSW 18 90527913 missense probably damaging 1.00
R2444:Tmx3 UTSW 18 90540183 missense probably damaging 1.00
R2960:Tmx3 UTSW 18 90532992 missense probably damaging 0.98
R3435:Tmx3 UTSW 18 90527904 missense probably damaging 1.00
R3946:Tmx3 UTSW 18 90524335 missense possibly damaging 0.78
R4427:Tmx3 UTSW 18 90523601 missense probably damaging 0.99
R5748:Tmx3 UTSW 18 90537101 missense probably benign 0.05
R5938:Tmx3 UTSW 18 90527934 missense possibly damaging 0.79
R6266:Tmx3 UTSW 18 90537210 splice site probably null
R7311:Tmx3 UTSW 18 90540071 missense probably benign 0.13
R7637:Tmx3 UTSW 18 90537109 missense probably damaging 0.99
R7649:Tmx3 UTSW 18 90540030 missense probably damaging 1.00
R7772:Tmx3 UTSW 18 90527794 splice site probably null
R7899:Tmx3 UTSW 18 90527874 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGAGTGTGCTGCTCTTAAAG -3'
(R):5'- GTTTCAAGCATCCCTGAGAGG -3'

Sequencing Primer
(F):5'- GCTTTAATAGAGGGGAATTGAG -3'
(R):5'- AGGTAGGAGTTGAGGATGTCC -3'
Posted On2015-10-21