Incidental Mutation 'R4708:Pde6c'
ID355452
Institutional Source Beutler Lab
Gene Symbol Pde6c
Ensembl Gene ENSMUSG00000024992
Gene Namephosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonymscpfl1
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location38132781-38183958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38180893 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 804 (E804K)
Ref Sequence ENSEMBL: ENSMUSP00000107948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025956] [ENSMUST00000112329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025956
AA Change: E829K

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025956
Gene: ENSMUSG00000024992
AA Change: E829K

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 7.57e-9 SMART
low complexity region 827 836 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112329
AA Change: E804K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107948
Gene: ENSMUSG00000024992
AA Change: E804K

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 1.62e-8 SMART
low complexity region 802 811 N/A INTRINSIC
Meta Mutation Damage Score 0.1151 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-prime subunit of cone phosphodiesterase, which is composed of a homodimer of two alpha-prime subunits and 3 smaller proteins of 11, 13, and 15 kDa. Mutations in this gene are associated with cone dystrophy type 4 (COD4). [provided by RefSeq, Mar 2010]
PHENOTYPE: A spontaneous mutation in this gene results in abnormal cone photoreceptor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Pde6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Pde6c APN 19 38162876 splice site probably benign
IGL01333:Pde6c APN 19 38175695 missense probably benign 0.05
IGL01390:Pde6c APN 19 38161928 missense probably benign 0.01
IGL02508:Pde6c APN 19 38157500 missense probably benign 0.13
IGL02542:Pde6c APN 19 38178130 missense probably damaging 1.00
IGL02546:Pde6c APN 19 38140040 missense probably benign 0.00
IGL02661:Pde6c APN 19 38180800 missense probably damaging 0.97
silverton UTSW 19 38162845 missense probably damaging 1.00
IGL03097:Pde6c UTSW 19 38178271 missense probably damaging 1.00
R0117:Pde6c UTSW 19 38151531 missense probably damaging 1.00
R0128:Pde6c UTSW 19 38169365 splice site probably benign
R0349:Pde6c UTSW 19 38162349 missense probably damaging 1.00
R0612:Pde6c UTSW 19 38133246 missense probably benign 0.03
R0692:Pde6c UTSW 19 38180250 missense probably damaging 0.99
R0785:Pde6c UTSW 19 38133180 missense probably benign
R1605:Pde6c UTSW 19 38141492 missense probably damaging 1.00
R1643:Pde6c UTSW 19 38161958 missense possibly damaging 0.56
R1694:Pde6c UTSW 19 38180225 missense probably damaging 1.00
R1781:Pde6c UTSW 19 38151698 missense possibly damaging 0.69
R1900:Pde6c UTSW 19 38161940 missense probably damaging 1.00
R1944:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R1945:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R2143:Pde6c UTSW 19 38162329 missense probably damaging 1.00
R2497:Pde6c UTSW 19 38153694 missense probably damaging 1.00
R3737:Pde6c UTSW 19 38140224 missense probably damaging 1.00
R4010:Pde6c UTSW 19 38169436 missense probably damaging 1.00
R4241:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4242:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4259:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4661:Pde6c UTSW 19 38169439 missense probably damaging 1.00
R4677:Pde6c UTSW 19 38157385 missense probably damaging 1.00
R4889:Pde6c UTSW 19 38133151 missense probably benign 0.23
R4898:Pde6c UTSW 19 38150624 missense possibly damaging 0.81
R4941:Pde6c UTSW 19 38151565 missense probably damaging 1.00
R5448:Pde6c UTSW 19 38133175 missense probably damaging 1.00
R6174:Pde6c UTSW 19 38140229 missense possibly damaging 0.57
R6249:Pde6c UTSW 19 38158560 critical splice donor site probably null
R6270:Pde6c UTSW 19 38158436 missense probably damaging 1.00
R7183:Pde6c UTSW 19 38133090 missense probably benign 0.00
R7428:Pde6c UTSW 19 38157536 critical splice donor site probably null
R7429:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7430:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7643:Pde6c UTSW 19 38141421 missense probably damaging 1.00
R7793:Pde6c UTSW 19 38159753 missense possibly damaging 0.94
R7811:Pde6c UTSW 19 38140059 missense possibly damaging 0.91
R8097:Pde6c UTSW 19 38161966 nonsense probably null
Z1176:Pde6c UTSW 19 38132881 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTCTACACCAGATCACGACTG -3'
(R):5'- GCATAAGATCTTGTCTGGGCG -3'

Sequencing Primer
(F):5'- TCTACACCAGATCACGACTGAAAGTC -3'
(R):5'- CTTGTCTGGGCGGTAAAATAACCC -3'
Posted On2015-10-21