Incidental Mutation 'R4709:Vmn2r26'
ID 355477
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 042018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R4709 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124053965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 553 (E553G)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: E553G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: E553G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158682
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 97% (77/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Abcf1 G A 17: 35,960,177 T463M probably damaging Het
Arhgap35 C T 7: 16,563,586 G518D probably damaging Het
Arhgdia A G 11: 120,579,691 Y110H probably damaging Het
Atp8b3 T C 10: 80,536,770 probably null Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cbr4 T C 8: 61,490,027 V77A possibly damaging Het
Cers2 A G 3: 95,320,223 Y54C possibly damaging Het
Cnbp A T 6: 87,844,138 H145Q probably damaging Het
Csmd1 A T 8: 16,023,891 I2030N possibly damaging Het
Csmd1 A G 8: 16,710,506 probably null Het
Dhodh T C 8: 109,601,538 probably null Het
Dnah11 T A 12: 118,018,760 Y2558F probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
En1 A T 1: 120,607,143 Y387F unknown Het
Ephb2 C A 4: 136,696,052 C305F probably damaging Het
Fryl A G 5: 73,080,972 V1477A probably benign Het
Gimap3 A T 6: 48,765,393 L201Q probably benign Het
Gm10801 T G 2: 98,663,901 probably null Het
Grhl1 A G 12: 24,586,133 I283V possibly damaging Het
Grid2ip T A 5: 143,388,903 L926H probably damaging Het
Gtf2h2 G T 13: 100,469,015 C82* probably null Het
Gtf2ird1 T C 5: 134,404,734 T280A probably benign Het
Gzmd T C 14: 56,130,241 I192V probably null Het
Hectd1 A G 12: 51,787,912 V855A possibly damaging Het
Hey1 A G 3: 8,665,903 probably benign Het
Hpx A G 7: 105,600,036 S19P probably benign Het
Incenp G A 19: 9,876,600 R696W unknown Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ldlrad3 A G 2: 102,069,998 I53T probably damaging Het
Map3k7 G T 4: 31,985,700 E208* probably null Het
Myh9 A T 15: 77,787,517 I458N probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nectin3 T A 16: 46,463,943 Y126F possibly damaging Het
Nek5 A T 8: 22,083,427 N504K probably damaging Het
Nlrp4c T A 7: 6,065,425 H108Q probably benign Het
Olfr1499 T A 19: 13,815,450 I47F possibly damaging Het
Olfr183 A T 16: 59,000,095 T137S probably benign Het
Olfr316 T C 11: 58,758,187 V174A possibly damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Olfr521 A T 7: 99,767,782 I207F probably damaging Het
Olfr975 A T 9: 39,949,869 L301M probably damaging Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pcdhb12 A G 18: 37,437,495 T565A probably benign Het
Pclo A G 5: 14,778,558 N4676D unknown Het
Pdlim1 T A 19: 40,222,736 H278L probably benign Het
Pfkfb3 G A 2: 11,493,908 T46M probably damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Plxna1 T C 6: 89,334,751 D924G possibly damaging Het
Postn T A 3: 54,384,610 probably benign Het
Ptpn23 A G 9: 110,388,856 S674P possibly damaging Het
Ranbp6 C T 19: 29,811,584 R456Q probably benign Het
Rbm43 A T 2: 51,929,716 V46E probably damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Ryr2 A G 13: 11,716,998 I2352T probably damaging Het
Sbk2 G T 7: 4,957,578 R198S possibly damaging Het
Scube3 G A 17: 28,167,192 probably null Het
Slc45a1 G A 4: 150,638,240 P396S probably benign Het
Slc4a10 A G 2: 62,257,517 D418G probably null Het
Smarcad1 A G 6: 65,075,115 T411A probably benign Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Stag1 G T 9: 100,738,039 R65L probably damaging Het
Stat1 A T 1: 52,126,521 D92V probably damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn1r172 A G 7: 23,660,181 T164A probably benign Het
Vmn2r118 A T 17: 55,610,860 D217E probably damaging Het
Vmn2r96 T C 17: 18,582,826 F333L probably benign Het
Ypel5 G A 17: 72,848,731 R98H probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zyg11a T C 4: 108,205,071 S176G probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGCTGTTAAAGTACACAGATGC -3'
(R):5'- GGTGTTGTGTTACTCACCCC -3'

Sequencing Primer
(F):5'- CTGCTGAAATTTACCATCTGGATGC -3'
(R):5'- ACTCACCCCTATCCTGTGGTG -3'
Posted On 2015-10-21