Incidental Mutation 'R4709:Arhgap35'
ID355480
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission 042018-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4709 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 16563586 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 518 (G518D)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect probably damaging
Transcript: ENSMUST00000075845
AA Change: G518D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: G518D

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171937
AA Change: G518D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: G518D

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Meta Mutation Damage Score 0.1000 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Abcf1 G A 17: 35,960,177 T463M probably damaging Het
Arhgdia A G 11: 120,579,691 Y110H probably damaging Het
Atp8b3 T C 10: 80,536,770 probably null Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cbr4 T C 8: 61,490,027 V77A possibly damaging Het
Cers2 A G 3: 95,320,223 Y54C possibly damaging Het
Cnbp A T 6: 87,844,138 H145Q probably damaging Het
Csmd1 A T 8: 16,023,891 I2030N possibly damaging Het
Csmd1 A G 8: 16,710,506 probably null Het
Dhodh T C 8: 109,601,538 probably null Het
Dnah11 T A 12: 118,018,760 Y2558F probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
En1 A T 1: 120,607,143 Y387F unknown Het
Ephb2 C A 4: 136,696,052 C305F probably damaging Het
Fryl A G 5: 73,080,972 V1477A probably benign Het
Gimap3 A T 6: 48,765,393 L201Q probably benign Het
Gm10801 T G 2: 98,663,901 probably null Het
Grhl1 A G 12: 24,586,133 I283V possibly damaging Het
Grid2ip T A 5: 143,388,903 L926H probably damaging Het
Gtf2h2 G T 13: 100,469,015 C82* probably null Het
Gtf2ird1 T C 5: 134,404,734 T280A probably benign Het
Gzmd T C 14: 56,130,241 I192V probably null Het
Hectd1 A G 12: 51,787,912 V855A possibly damaging Het
Hey1 A G 3: 8,665,903 probably benign Het
Hpx A G 7: 105,600,036 S19P probably benign Het
Incenp G A 19: 9,876,600 R696W unknown Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ldlrad3 A G 2: 102,069,998 I53T probably damaging Het
Map3k7 G T 4: 31,985,700 E208* probably null Het
Myh9 A T 15: 77,787,517 I458N probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nectin3 T A 16: 46,463,943 Y126F possibly damaging Het
Nek5 A T 8: 22,083,427 N504K probably damaging Het
Nlrp4c T A 7: 6,065,425 H108Q probably benign Het
Olfr1499 T A 19: 13,815,450 I47F possibly damaging Het
Olfr183 A T 16: 59,000,095 T137S probably benign Het
Olfr316 T C 11: 58,758,187 V174A possibly damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Olfr521 A T 7: 99,767,782 I207F probably damaging Het
Olfr975 A T 9: 39,949,869 L301M probably damaging Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pcdhb12 A G 18: 37,437,495 T565A probably benign Het
Pclo A G 5: 14,778,558 N4676D unknown Het
Pdlim1 T A 19: 40,222,736 H278L probably benign Het
Pfkfb3 G A 2: 11,493,908 T46M probably damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Plxna1 T C 6: 89,334,751 D924G possibly damaging Het
Postn T A 3: 54,384,610 probably benign Het
Ptpn23 A G 9: 110,388,856 S674P possibly damaging Het
Ranbp6 C T 19: 29,811,584 R456Q probably benign Het
Rbm43 A T 2: 51,929,716 V46E probably damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Ryr2 A G 13: 11,716,998 I2352T probably damaging Het
Sbk2 G T 7: 4,957,578 R198S possibly damaging Het
Scube3 G A 17: 28,167,192 probably null Het
Slc45a1 G A 4: 150,638,240 P396S probably benign Het
Slc4a10 A G 2: 62,257,517 D418G probably null Het
Smarcad1 A G 6: 65,075,115 T411A probably benign Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Stag1 G T 9: 100,738,039 R65L probably damaging Het
Stat1 A T 1: 52,126,521 D92V probably damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn1r172 A G 7: 23,660,181 T164A probably benign Het
Vmn2r118 A T 17: 55,610,860 D217E probably damaging Het
Vmn2r26 A G 6: 124,053,965 E553G probably damaging Het
Vmn2r96 T C 17: 18,582,826 F333L probably benign Het
Ypel5 G A 17: 72,848,731 R98H probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zyg11a T C 4: 108,205,071 S176G probably benign Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
R8101:Arhgap35 UTSW 7 16562319 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGACAGAGAGTTCTTCTG -3'
(R):5'- TGAATGAAGACTTCTACCAGTGGC -3'

Sequencing Primer
(F):5'- CAGACAGAGAGTTCTTCTGATTCCG -3'
(R):5'- CAGTGGCTGGAAGAATCTGTGTAC -3'
Posted On2015-10-21