Incidental Mutation 'R4709:Olfr975'
ID355491
Institutional Source Beutler Lab
Gene Symbol Olfr975
Ensembl Gene ENSMUSG00000043331
Gene Nameolfactory receptor 975
SynonymsMOR224-2, GA_x6K02T2PVTD-33651220-33650288
MMRRC Submission 042018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4709 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39948131-39952046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39949869 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 301 (L301M)
Ref Sequence ENSEMBL: ENSMUSP00000150664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054067] [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000213246] [ENSMUST00000216647] [ENSMUST00000217630]
Predicted Effect probably damaging
Transcript: ENSMUST00000054067
AA Change: L301M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059776
Gene: ENSMUSG00000043331
AA Change: L301M

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 249 1.8e-7 PFAM
Pfam:7tm_1 39 286 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169307
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213171
Predicted Effect probably benign
Transcript: ENSMUST00000213246
Predicted Effect probably damaging
Transcript: ENSMUST00000216647
AA Change: L301M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000217630
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Abcf1 G A 17: 35,960,177 T463M probably damaging Het
Arhgap35 C T 7: 16,563,586 G518D probably damaging Het
Arhgdia A G 11: 120,579,691 Y110H probably damaging Het
Atp8b3 T C 10: 80,536,770 probably null Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cbr4 T C 8: 61,490,027 V77A possibly damaging Het
Cers2 A G 3: 95,320,223 Y54C possibly damaging Het
Cnbp A T 6: 87,844,138 H145Q probably damaging Het
Csmd1 A T 8: 16,023,891 I2030N possibly damaging Het
Csmd1 A G 8: 16,710,506 probably null Het
Dhodh T C 8: 109,601,538 probably null Het
Dnah11 T A 12: 118,018,760 Y2558F probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
En1 A T 1: 120,607,143 Y387F unknown Het
Ephb2 C A 4: 136,696,052 C305F probably damaging Het
Fryl A G 5: 73,080,972 V1477A probably benign Het
Gimap3 A T 6: 48,765,393 L201Q probably benign Het
Gm10801 T G 2: 98,663,901 probably null Het
Grhl1 A G 12: 24,586,133 I283V possibly damaging Het
Grid2ip T A 5: 143,388,903 L926H probably damaging Het
Gtf2h2 G T 13: 100,469,015 C82* probably null Het
Gtf2ird1 T C 5: 134,404,734 T280A probably benign Het
Gzmd T C 14: 56,130,241 I192V probably null Het
Hectd1 A G 12: 51,787,912 V855A possibly damaging Het
Hey1 A G 3: 8,665,903 probably benign Het
Hpx A G 7: 105,600,036 S19P probably benign Het
Incenp G A 19: 9,876,600 R696W unknown Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ldlrad3 A G 2: 102,069,998 I53T probably damaging Het
Map3k7 G T 4: 31,985,700 E208* probably null Het
Myh9 A T 15: 77,787,517 I458N probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nectin3 T A 16: 46,463,943 Y126F possibly damaging Het
Nek5 A T 8: 22,083,427 N504K probably damaging Het
Nlrp4c T A 7: 6,065,425 H108Q probably benign Het
Olfr1499 T A 19: 13,815,450 I47F possibly damaging Het
Olfr183 A T 16: 59,000,095 T137S probably benign Het
Olfr316 T C 11: 58,758,187 V174A possibly damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Olfr521 A T 7: 99,767,782 I207F probably damaging Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pcdhb12 A G 18: 37,437,495 T565A probably benign Het
Pclo A G 5: 14,778,558 N4676D unknown Het
Pdlim1 T A 19: 40,222,736 H278L probably benign Het
Pfkfb3 G A 2: 11,493,908 T46M probably damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Plxna1 T C 6: 89,334,751 D924G possibly damaging Het
Postn T A 3: 54,384,610 probably benign Het
Ptpn23 A G 9: 110,388,856 S674P possibly damaging Het
Ranbp6 C T 19: 29,811,584 R456Q probably benign Het
Rbm43 A T 2: 51,929,716 V46E probably damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Ryr2 A G 13: 11,716,998 I2352T probably damaging Het
Sbk2 G T 7: 4,957,578 R198S possibly damaging Het
Scube3 G A 17: 28,167,192 probably null Het
Slc45a1 G A 4: 150,638,240 P396S probably benign Het
Slc4a10 A G 2: 62,257,517 D418G probably null Het
Smarcad1 A G 6: 65,075,115 T411A probably benign Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Stag1 G T 9: 100,738,039 R65L probably damaging Het
Stat1 A T 1: 52,126,521 D92V probably damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn1r172 A G 7: 23,660,181 T164A probably benign Het
Vmn2r118 A T 17: 55,610,860 D217E probably damaging Het
Vmn2r26 A G 6: 124,053,965 E553G probably damaging Het
Vmn2r96 T C 17: 18,582,826 F333L probably benign Het
Ypel5 G A 17: 72,848,731 R98H probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zyg11a T C 4: 108,205,071 S176G probably benign Het
Other mutations in Olfr975
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Olfr975 APN 9 39949988 missense probably benign 0.01
IGL01537:Olfr975 APN 9 39950625 missense probably benign 0.00
IGL01963:Olfr975 APN 9 39950240 missense probably damaging 1.00
IGL02400:Olfr975 APN 9 39950339 missense probably benign
IGL03115:Olfr975 APN 9 39950744 missense probably damaging 0.98
IGL03226:Olfr975 APN 9 39950423 unclassified probably null
R0088:Olfr975 UTSW 9 39950375 missense probably benign 0.03
R0212:Olfr975 UTSW 9 39949940 missense probably benign 0.44
R1668:Olfr975 UTSW 9 39950169 missense possibly damaging 0.94
R1878:Olfr975 UTSW 9 39950757 missense probably benign 0.35
R2225:Olfr975 UTSW 9 39950537 missense possibly damaging 0.84
R2291:Olfr975 UTSW 9 39950334 missense probably benign 0.19
R2420:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2421:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2422:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2425:Olfr975 UTSW 9 39949841 missense probably null 0.25
R2918:Olfr975 UTSW 9 39950364 missense probably benign
R4536:Olfr975 UTSW 9 39950435 missense probably damaging 1.00
R4831:Olfr975 UTSW 9 39950112 missense probably benign 0.01
R4921:Olfr975 UTSW 9 39950225 missense probably damaging 0.98
R5113:Olfr975 UTSW 9 39949925 missense probably damaging 0.99
R5141:Olfr975 UTSW 9 39949874 missense probably benign 0.07
R5195:Olfr975 UTSW 9 39950679 missense probably benign
R5213:Olfr975 UTSW 9 39950093 missense probably damaging 0.99
R5568:Olfr975 UTSW 9 39950687 missense probably benign 0.05
R6993:Olfr975 UTSW 9 39950637 missense probably benign
R7080:Olfr975 UTSW 9 39950148 missense probably damaging 1.00
R7436:Olfr975 UTSW 9 39950053 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCAGCGTCGTTCTTCCTG -3'
(R):5'- TGCAGTGCCCACTTGACATC -3'

Sequencing Primer
(F):5'- TCTTCCTGGCCAGTTGAGCG -3'
(R):5'- AGTGCCCACTTGACATCCATTC -3'
Posted On2015-10-21