Incidental Mutation 'R4709:Atp8b3'
ID355496
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission 042018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4709 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationunclassified (4894 bp from exon)
DNA Base Change (assembly) T to C at 80536770 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000057910] [ENSMUST00000219648] [ENSMUST00000220326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020383
AA Change: D12G

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: D12G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000057910
SMART Domains Protein: ENSMUSP00000049705
Gene: ENSMUSG00000047417

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
coiled coil region 83 113 N/A INTRINSIC
low complexity region 180 188 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
low complexity region 507 525 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
low complexity region 561 583 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
Pfam:EloA-BP1 794 954 3.8e-72 PFAM
EXOIII 1051 1210 2.36e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182682
Predicted Effect probably damaging
Transcript: ENSMUST00000219648
AA Change: D12G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220326
AA Change: D12G

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1950 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Abcf1 G A 17: 35,960,177 T463M probably damaging Het
Arhgap35 C T 7: 16,563,586 G518D probably damaging Het
Arhgdia A G 11: 120,579,691 Y110H probably damaging Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cbr4 T C 8: 61,490,027 V77A possibly damaging Het
Cers2 A G 3: 95,320,223 Y54C possibly damaging Het
Cnbp A T 6: 87,844,138 H145Q probably damaging Het
Csmd1 A T 8: 16,023,891 I2030N possibly damaging Het
Csmd1 A G 8: 16,710,506 probably null Het
Dhodh T C 8: 109,601,538 probably null Het
Dnah11 T A 12: 118,018,760 Y2558F probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
En1 A T 1: 120,607,143 Y387F unknown Het
Ephb2 C A 4: 136,696,052 C305F probably damaging Het
Fryl A G 5: 73,080,972 V1477A probably benign Het
Gimap3 A T 6: 48,765,393 L201Q probably benign Het
Gm10801 T G 2: 98,663,901 probably null Het
Grhl1 A G 12: 24,586,133 I283V possibly damaging Het
Grid2ip T A 5: 143,388,903 L926H probably damaging Het
Gtf2h2 G T 13: 100,469,015 C82* probably null Het
Gtf2ird1 T C 5: 134,404,734 T280A probably benign Het
Gzmd T C 14: 56,130,241 I192V probably null Het
Hectd1 A G 12: 51,787,912 V855A possibly damaging Het
Hey1 A G 3: 8,665,903 probably benign Het
Hpx A G 7: 105,600,036 S19P probably benign Het
Incenp G A 19: 9,876,600 R696W unknown Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ldlrad3 A G 2: 102,069,998 I53T probably damaging Het
Map3k7 G T 4: 31,985,700 E208* probably null Het
Myh9 A T 15: 77,787,517 I458N probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nectin3 T A 16: 46,463,943 Y126F possibly damaging Het
Nek5 A T 8: 22,083,427 N504K probably damaging Het
Nlrp4c T A 7: 6,065,425 H108Q probably benign Het
Olfr1499 T A 19: 13,815,450 I47F possibly damaging Het
Olfr183 A T 16: 59,000,095 T137S probably benign Het
Olfr316 T C 11: 58,758,187 V174A possibly damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Olfr521 A T 7: 99,767,782 I207F probably damaging Het
Olfr975 A T 9: 39,949,869 L301M probably damaging Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pcdhb12 A G 18: 37,437,495 T565A probably benign Het
Pclo A G 5: 14,778,558 N4676D unknown Het
Pdlim1 T A 19: 40,222,736 H278L probably benign Het
Pfkfb3 G A 2: 11,493,908 T46M probably damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Plxna1 T C 6: 89,334,751 D924G possibly damaging Het
Postn T A 3: 54,384,610 probably benign Het
Ptpn23 A G 9: 110,388,856 S674P possibly damaging Het
Ranbp6 C T 19: 29,811,584 R456Q probably benign Het
Rbm43 A T 2: 51,929,716 V46E probably damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Ryr2 A G 13: 11,716,998 I2352T probably damaging Het
Sbk2 G T 7: 4,957,578 R198S possibly damaging Het
Scube3 G A 17: 28,167,192 probably null Het
Slc45a1 G A 4: 150,638,240 P396S probably benign Het
Slc4a10 A G 2: 62,257,517 D418G probably null Het
Smarcad1 A G 6: 65,075,115 T411A probably benign Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Stag1 G T 9: 100,738,039 R65L probably damaging Het
Stat1 A T 1: 52,126,521 D92V probably damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn1r172 A G 7: 23,660,181 T164A probably benign Het
Vmn2r118 A T 17: 55,610,860 D217E probably damaging Het
Vmn2r26 A G 6: 124,053,965 E553G probably damaging Het
Vmn2r96 T C 17: 18,582,826 F333L probably benign Het
Ypel5 G A 17: 72,848,731 R98H probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zyg11a T C 4: 108,205,071 S176G probably benign Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80530586 missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7051:Atp8b3 UTSW 10 80529718 missense probably damaging 0.99
R7052:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80530092 missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80529629 critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80520146 missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80524406 missense probably damaging 0.99
R8077:Atp8b3 UTSW 10 80531024 missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80529816 missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80526236 missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80531077 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACTTCCACTCAGGGATCAG -3'
(R):5'- GTGAATACCTAGGGCTACTTCTTTTC -3'

Sequencing Primer
(F):5'- GATCAGGGTCCCAGCAACTC -3'
(R):5'- GACTTGAAGCCATCCATACTCGTG -3'
Posted On2015-10-21