Mutagenetix > Incidental Mutations

Incidental Mutation 'R4709:Pdlim1'

355521

Institutional Source

Beutler Lab

Gene Symbol

Pdlim1

Ensembl Gene

ENSMUSG00000055044

Gene Name

PDZ and LIM domain 1 (elfin)

Synonyms

CLP36, mClim1

MMRRC Submission

042018-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4709 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40221173-40271842 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40222736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 278 (H278L)

Ref Sequence

ENSEMBL: ENSMUSP00000064545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068439]

AlphaFold

O70400

Predicted Effect

probably benign
Transcript: ENSMUST00000068439
AA Change: H278L

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000064545
Gene: ENSMUSG00000055044
AA Change: H278L

Domain	Start	End	E-Value	Type
PDZ	12	85	3.23e-18	SMART
Pfam:DUF4749	136	234	4.6e-29	PFAM
LIM	257	308	2.31e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182813

Meta Mutation Damage Score

0.9531

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enigma protein family. The protein contains two protein interacting domains, a PDZ domain at the amino terminal end and one to three LIM domains at the carboxyl terminal. It is a cytoplasmic protein associated with the cytoskeleton. The protein may function as an adapter to bring other LIM-interacting proteins to the cytoskeleton. Pseudogenes associated with this gene are located on chromosomes 3, 14 and 17. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced platelet response to GPVI agonists and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,578,381	I139V	probably benign	Het
Abcf1	G	A	17: 35,960,177	T463M	probably damaging	Het
Arhgap35	C	T	7: 16,563,586	G518D	probably damaging	Het
Arhgdia	A	G	11: 120,579,691	Y110H	probably damaging	Het
Atp8b3	T	C	10: 80,536,770		probably null	Het
Bpifb6	T	A	2: 153,908,516	I309N	possibly damaging	Het
Cbr4	T	C	8: 61,490,027	V77A	possibly damaging	Het
Cers2	A	G	3: 95,320,223	Y54C	possibly damaging	Het
Cnbp	A	T	6: 87,844,138	H145Q	probably damaging	Het
Csmd1	A	T	8: 16,023,891	I2030N	possibly damaging	Het
Csmd1	A	G	8: 16,710,506		probably null	Het
Dhodh	T	C	8: 109,601,538		probably null	Het
Dnah11	T	A	12: 118,018,760	Y2558F	probably benign	Het
Dysf	C	A	6: 84,097,715	D499E	probably damaging	Het
En1	A	T	1: 120,607,143	Y387F	unknown	Het
Ephb2	C	A	4: 136,696,052	C305F	probably damaging	Het
Fryl	A	G	5: 73,080,972	V1477A	probably benign	Het
Gimap3	A	T	6: 48,765,393	L201Q	probably benign	Het
Gm10801	T	G	2: 98,663,901		probably null	Het
Grhl1	A	G	12: 24,586,133	I283V	possibly damaging	Het
Grid2ip	T	A	5: 143,388,903	L926H	probably damaging	Het
Gtf2h2	G	T	13: 100,469,015	C82*	probably null	Het
Gtf2ird1	T	C	5: 134,404,734	T280A	probably benign	Het
Gzmd	T	C	14: 56,130,241	I192V	probably null	Het
Hectd1	A	G	12: 51,787,912	V855A	possibly damaging	Het
Hey1	A	G	3: 8,665,903		probably benign	Het
Hpx	A	G	7: 105,600,036	S19P	probably benign	Het
Incenp	G	A	19: 9,876,600	R696W	unknown	Het
Itgam	T	C	7: 128,101,537	V493A	probably damaging	Het
Ldlrad3	A	G	2: 102,069,998	I53T	probably damaging	Het
Map3k7	G	T	4: 31,985,700	E208*	probably null	Het
Myh9	A	T	15: 77,787,517	I458N	probably damaging	Het
Myo1c	C	T	11: 75,670,030	R770*	probably null	Het
Nectin3	T	A	16: 46,463,943	Y126F	possibly damaging	Het
Nek5	A	T	8: 22,083,427	N504K	probably damaging	Het
Nlrp4c	T	A	7: 6,065,425	H108Q	probably benign	Het
Olfr1499	T	A	19: 13,815,450	I47F	possibly damaging	Het
Olfr183	A	T	16: 59,000,095	T137S	probably benign	Het
Olfr316	T	C	11: 58,758,187	V174A	possibly damaging	Het
Olfr459	G	T	6: 41,771,508	Q264K	probably benign	Het
Olfr521	A	T	7: 99,767,782	I207F	probably damaging	Het
Olfr975	A	T	9: 39,949,869	L301M	probably damaging	Het
Parp6	T	C	9: 59,641,769	I507T	probably damaging	Het
Pcdhb12	A	G	18: 37,437,495	T565A	probably benign	Het
Pclo	A	G	5: 14,778,558	N4676D	unknown	Het
Pfkfb3	G	A	2: 11,493,908	T46M	probably damaging	Het
Plscr2	A	G	9: 92,291,014	Y203C	probably damaging	Het
Plxna1	T	C	6: 89,334,751	D924G	possibly damaging	Het
Postn	T	A	3: 54,384,610		probably benign	Het
Ptpn23	A	G	9: 110,388,856	S674P	possibly damaging	Het
Ranbp6	C	T	19: 29,811,584	R456Q	probably benign	Het
Rbm43	A	T	2: 51,929,716	V46E	probably damaging	Het
Rtn4r	A	G	16: 18,151,182	Y158C	probably damaging	Het
Ryr2	A	G	13: 11,716,998	I2352T	probably damaging	Het
Sbk2	G	T	7: 4,957,578	R198S	possibly damaging	Het
Scube3	G	A	17: 28,167,192		probably null	Het
Slc45a1	G	A	4: 150,638,240	P396S	probably benign	Het
Slc4a10	A	G	2: 62,257,517	D418G	probably null	Het
Smarcad1	A	G	6: 65,075,115	T411A	probably benign	Het
Smtn	G	A	11: 3,524,663	S716F	probably damaging	Het
Stag1	G	T	9: 100,738,039	R65L	probably damaging	Het
Stat1	A	T	1: 52,126,521	D92V	probably damaging	Het
Ttn	A	G	2: 76,752,084	Y22822H	probably damaging	Het
Vmn1r172	A	G	7: 23,660,181	T164A	probably benign	Het
Vmn2r118	A	T	17: 55,610,860	D217E	probably damaging	Het
Vmn2r26	A	G	6: 124,053,965	E553G	probably damaging	Het
Vmn2r96	T	C	17: 18,582,826	F333L	probably benign	Het
Ypel5	G	A	17: 72,848,731	R98H	probably benign	Het
Zfp719	C	T	7: 43,590,232	H415Y	probably damaging	Het
Zyg11a	T	C	4: 108,205,071	S176G	probably benign	Het

Other mutations in Pdlim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02027:Pdlim1	APN	19	40243466	missense	probably benign	0.00
IGL02253:Pdlim1	APN	19	40230530	missense	probably damaging	0.99
IGL02312:Pdlim1	APN	19	40223061	missense	probably benign	0.00
IGL02584:Pdlim1	APN	19	40243400	splice site	probably null
R0391:Pdlim1	UTSW	19	40243573	missense	probably damaging	0.99
R1554:Pdlim1	UTSW	19	40223072	missense	probably benign	0.19
R1751:Pdlim1	UTSW	19	40251904	splice site	probably benign
R1972:Pdlim1	UTSW	19	40223137	missense	probably damaging	0.99
R2900:Pdlim1	UTSW	19	40223075	missense	probably damaging	1.00
R4803:Pdlim1	UTSW	19	40243448	missense	possibly damaging	0.94
R4818:Pdlim1	UTSW	19	40223136	missense	probably damaging	0.98
R5360:Pdlim1	UTSW	19	40230549	missense	probably damaging	0.99
R5833:Pdlim1	UTSW	19	40230545	missense	probably damaging	1.00
R6547:Pdlim1	UTSW	19	40223120	missense	probably damaging	0.97
R7699:Pdlim1	UTSW	19	40249658	missense	probably damaging	0.99
R7700:Pdlim1	UTSW	19	40249658	missense	probably damaging	0.99
R7756:Pdlim1	UTSW	19	40243542	missense	probably benign	0.00
R7758:Pdlim1	UTSW	19	40243542	missense	probably benign	0.00
R7914:Pdlim1	UTSW	19	40252001	missense	probably damaging	0.98
R8201:Pdlim1	UTSW	19	40230514	missense	probably benign
R8331:Pdlim1	UTSW	19	40230551	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CAGAATATTCCGAGAACCAGGTG -3'
(R):5'- AGAGGCTTTTAGAATGACGAGTC -3'

Sequencing Primer
(F):5'- AACCAGGTGCAGCAGGC -3'
(R):5'- AGGCTTTTAGAATGACGAGTCTTCCC -3'

Posted On

2015-10-21