Incidental Mutation 'R4709:Pdlim1'
ID 355521
Institutional Source Beutler Lab
Gene Symbol Pdlim1
Ensembl Gene ENSMUSG00000055044
Gene Name PDZ and LIM domain 1 (elfin)
Synonyms CLP36, mClim1
MMRRC Submission 042018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4709 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 40221173-40271842 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40222736 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 278 (H278L)
Ref Sequence ENSEMBL: ENSMUSP00000064545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068439]
AlphaFold O70400
Predicted Effect probably benign
Transcript: ENSMUST00000068439
AA Change: H278L

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064545
Gene: ENSMUSG00000055044
AA Change: H278L

DomainStartEndE-ValueType
PDZ 12 85 3.23e-18 SMART
Pfam:DUF4749 136 234 4.6e-29 PFAM
LIM 257 308 2.31e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182813
Meta Mutation Damage Score 0.9531 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enigma protein family. The protein contains two protein interacting domains, a PDZ domain at the amino terminal end and one to three LIM domains at the carboxyl terminal. It is a cytoplasmic protein associated with the cytoskeleton. The protein may function as an adapter to bring other LIM-interacting proteins to the cytoskeleton. Pseudogenes associated with this gene are located on chromosomes 3, 14 and 17. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced platelet response to GPVI agonists and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Abcf1 G A 17: 35,960,177 T463M probably damaging Het
Arhgap35 C T 7: 16,563,586 G518D probably damaging Het
Arhgdia A G 11: 120,579,691 Y110H probably damaging Het
Atp8b3 T C 10: 80,536,770 probably null Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cbr4 T C 8: 61,490,027 V77A possibly damaging Het
Cers2 A G 3: 95,320,223 Y54C possibly damaging Het
Cnbp A T 6: 87,844,138 H145Q probably damaging Het
Csmd1 A T 8: 16,023,891 I2030N possibly damaging Het
Csmd1 A G 8: 16,710,506 probably null Het
Dhodh T C 8: 109,601,538 probably null Het
Dnah11 T A 12: 118,018,760 Y2558F probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
En1 A T 1: 120,607,143 Y387F unknown Het
Ephb2 C A 4: 136,696,052 C305F probably damaging Het
Fryl A G 5: 73,080,972 V1477A probably benign Het
Gimap3 A T 6: 48,765,393 L201Q probably benign Het
Gm10801 T G 2: 98,663,901 probably null Het
Grhl1 A G 12: 24,586,133 I283V possibly damaging Het
Grid2ip T A 5: 143,388,903 L926H probably damaging Het
Gtf2h2 G T 13: 100,469,015 C82* probably null Het
Gtf2ird1 T C 5: 134,404,734 T280A probably benign Het
Gzmd T C 14: 56,130,241 I192V probably null Het
Hectd1 A G 12: 51,787,912 V855A possibly damaging Het
Hey1 A G 3: 8,665,903 probably benign Het
Hpx A G 7: 105,600,036 S19P probably benign Het
Incenp G A 19: 9,876,600 R696W unknown Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ldlrad3 A G 2: 102,069,998 I53T probably damaging Het
Map3k7 G T 4: 31,985,700 E208* probably null Het
Myh9 A T 15: 77,787,517 I458N probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nectin3 T A 16: 46,463,943 Y126F possibly damaging Het
Nek5 A T 8: 22,083,427 N504K probably damaging Het
Nlrp4c T A 7: 6,065,425 H108Q probably benign Het
Olfr1499 T A 19: 13,815,450 I47F possibly damaging Het
Olfr183 A T 16: 59,000,095 T137S probably benign Het
Olfr316 T C 11: 58,758,187 V174A possibly damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Olfr521 A T 7: 99,767,782 I207F probably damaging Het
Olfr975 A T 9: 39,949,869 L301M probably damaging Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pcdhb12 A G 18: 37,437,495 T565A probably benign Het
Pclo A G 5: 14,778,558 N4676D unknown Het
Pfkfb3 G A 2: 11,493,908 T46M probably damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Plxna1 T C 6: 89,334,751 D924G possibly damaging Het
Postn T A 3: 54,384,610 probably benign Het
Ptpn23 A G 9: 110,388,856 S674P possibly damaging Het
Ranbp6 C T 19: 29,811,584 R456Q probably benign Het
Rbm43 A T 2: 51,929,716 V46E probably damaging Het
Rtn4r A G 16: 18,151,182 Y158C probably damaging Het
Ryr2 A G 13: 11,716,998 I2352T probably damaging Het
Sbk2 G T 7: 4,957,578 R198S possibly damaging Het
Scube3 G A 17: 28,167,192 probably null Het
Slc45a1 G A 4: 150,638,240 P396S probably benign Het
Slc4a10 A G 2: 62,257,517 D418G probably null Het
Smarcad1 A G 6: 65,075,115 T411A probably benign Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Stag1 G T 9: 100,738,039 R65L probably damaging Het
Stat1 A T 1: 52,126,521 D92V probably damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn1r172 A G 7: 23,660,181 T164A probably benign Het
Vmn2r118 A T 17: 55,610,860 D217E probably damaging Het
Vmn2r26 A G 6: 124,053,965 E553G probably damaging Het
Vmn2r96 T C 17: 18,582,826 F333L probably benign Het
Ypel5 G A 17: 72,848,731 R98H probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zyg11a T C 4: 108,205,071 S176G probably benign Het
Other mutations in Pdlim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Pdlim1 APN 19 40243466 missense probably benign 0.00
IGL02253:Pdlim1 APN 19 40230530 missense probably damaging 0.99
IGL02312:Pdlim1 APN 19 40223061 missense probably benign 0.00
IGL02584:Pdlim1 APN 19 40243400 splice site probably null
R0391:Pdlim1 UTSW 19 40243573 missense probably damaging 0.99
R1554:Pdlim1 UTSW 19 40223072 missense probably benign 0.19
R1751:Pdlim1 UTSW 19 40251904 splice site probably benign
R1972:Pdlim1 UTSW 19 40223137 missense probably damaging 0.99
R2900:Pdlim1 UTSW 19 40223075 missense probably damaging 1.00
R4803:Pdlim1 UTSW 19 40243448 missense possibly damaging 0.94
R4818:Pdlim1 UTSW 19 40223136 missense probably damaging 0.98
R5360:Pdlim1 UTSW 19 40230549 missense probably damaging 0.99
R5833:Pdlim1 UTSW 19 40230545 missense probably damaging 1.00
R6547:Pdlim1 UTSW 19 40223120 missense probably damaging 0.97
R7699:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7700:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7756:Pdlim1 UTSW 19 40243542 missense probably benign 0.00
R7758:Pdlim1 UTSW 19 40243542 missense probably benign 0.00
R7914:Pdlim1 UTSW 19 40252001 missense probably damaging 0.98
R8201:Pdlim1 UTSW 19 40230514 missense probably benign
R8331:Pdlim1 UTSW 19 40230551 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CAGAATATTCCGAGAACCAGGTG -3'
(R):5'- AGAGGCTTTTAGAATGACGAGTC -3'

Sequencing Primer
(F):5'- AACCAGGTGCAGCAGGC -3'
(R):5'- AGGCTTTTAGAATGACGAGTCTTCCC -3'
Posted On 2015-10-21