Incidental Mutation 'R4694:Lck'
ID355547
Institutional Source Beutler Lab
Gene Symbol Lck
Ensembl Gene ENSMUSG00000000409
Gene Namelymphocyte protein tyrosine kinase
SynonymsHck-3, p56
MMRRC Submission 041945-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4694 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129548344-129573641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129548972 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 452 (N452K)
Ref Sequence ENSEMBL: ENSMUSP00000099656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000167288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067240
AA Change: N452K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: N452K

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102596
AA Change: N452K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: N452K

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132030
Predicted Effect probably benign
Transcript: ENSMUST00000167288
AA Change: N463K

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: N463K

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,672,158 F258Y probably damaging Het
Adamtsl4 C T 3: 95,679,745 R765H probably damaging Het
Bicd1 T A 6: 149,409,553 L42Q probably damaging Het
Cacna1e C T 1: 154,437,266 probably null Het
Capn1 T A 19: 5,994,731 K504* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep350 T C 1: 155,928,586 K917R probably damaging Het
Cp A T 3: 19,974,885 T509S probably benign Het
Cyp2d10 T C 15: 82,404,483 D266G probably damaging Het
Dhodh C G 8: 109,606,416 R7P probably damaging Het
Dmxl2 A G 9: 54,446,905 L419P probably benign Het
Epb41l4b A T 4: 57,019,875 M84K probably benign Het
Fbln7 A G 2: 128,880,425 probably null Het
Fbxw11 C T 11: 32,642,820 probably benign Het
Flnc C A 6: 29,443,448 P543T probably damaging Het
Gm13103 T C 4: 143,852,960 S372P probably damaging Het
Grid1 T C 14: 35,026,780 S186P probably damaging Het
Hcfc2 C T 10: 82,723,700 T382M probably damaging Het
Hdac9 G T 12: 34,437,247 L73I probably damaging Het
Hnrnpa2b1 A T 6: 51,464,183 D302E probably damaging Het
Ifi204 C T 1: 173,749,259 C592Y probably damaging Het
Jph1 T A 1: 16,997,505 I653F probably damaging Het
Kcnj3 A G 2: 55,594,906 K339E probably benign Het
Kcp G A 6: 29,493,197 T838I probably benign Het
Krtap26-1 A T 16: 88,647,220 V171E possibly damaging Het
Madd A G 2: 91,160,328 L1134S probably damaging Het
Mafk T C 5: 139,800,493 S149P probably damaging Het
Man1c1 T C 4: 134,703,189 D94G probably benign Het
Me2 T A 18: 73,801,859 M38L probably benign Het
Muc2 A C 7: 141,752,345 D257A probably damaging Het
Myh11 T C 16: 14,200,702 K1927E probably damaging Het
Naaladl1 C T 19: 6,108,890 P324S probably damaging Het
Ndufa10 T C 1: 92,452,102 E303G probably benign Het
Nedd1 C T 10: 92,719,582 V14I probably benign Het
Nwd1 T G 8: 72,667,330 V407G probably damaging Het
Olfr1136 T A 2: 87,693,760 T41S probably benign Het
Olfr132 A C 17: 38,130,857 C112G probably damaging Het
Olfr32 T A 2: 90,138,249 K297* probably null Het
Olfr726 T C 14: 50,084,019 I221V probably benign Het
Olfr847 A G 9: 19,375,398 L161P probably damaging Het
Pgrmc2 T C 3: 41,070,405 D144G probably damaging Het
Ppp3cb T C 14: 20,501,515 N516S probably benign Het
Prelp A G 1: 133,914,747 M220T probably damaging Het
Prss36 A G 7: 127,935,615 W465R probably damaging Het
Pth2r C A 1: 65,336,761 F59L probably benign Het
Rab20 C T 8: 11,454,485 G72R probably damaging Het
Rab4a G T 8: 123,829,030 G49W probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rock1 A T 18: 10,136,152 Y178* probably null Het
Scaf8 C A 17: 3,197,404 L1001I probably damaging Het
Sema3b G A 9: 107,605,002 P26S probably benign Het
Slc23a1 A G 18: 35,619,580 L548P probably damaging Het
Sncaip A C 18: 52,906,557 T548P probably benign Het
Stpg2 C T 3: 139,317,416 P398S possibly damaging Het
Stpg3 A C 2: 25,213,297 V260G probably damaging Het
Tbc1d9 T A 8: 83,234,246 F242I probably damaging Het
Tnks1bp1 G A 2: 85,071,722 R992Q probably damaging Het
Tom1l1 T G 11: 90,646,849 H394P possibly damaging Het
Topors T G 4: 40,261,442 N614T possibly damaging Het
Trank1 A T 9: 111,392,061 Q2622L probably benign Het
Trub2 A G 2: 29,778,846 S186P probably damaging Het
Unc13c T A 9: 73,572,354 H1756L probably benign Het
Vmn1r9 A T 6: 57,071,329 I130F probably benign Het
Wdr72 A T 9: 74,179,555 I602F probably damaging Het
Zfand3 T A 17: 30,135,388 F60I possibly damaging Het
Zfp946 G A 17: 22,455,711 G482E probably benign Het
Other mutations in Lck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Lck APN 4 129558146 missense probably benign 0.00
IGL02666:Lck APN 4 129556419 missense probably damaging 0.98
iconoclast UTSW 4 129555604 missense probably damaging 1.00
lockdown UTSW 4 129558127 missense probably damaging 1.00
stromberg UTSW 4 129555640 missense probably damaging 1.00
swan UTSW 4 129555640 missense probably damaging 1.00
R0091:Lck UTSW 4 129555681 missense possibly damaging 0.88
R0480:Lck UTSW 4 129555640 missense probably damaging 1.00
R1013:Lck UTSW 4 129558127 missense probably damaging 1.00
R1510:Lck UTSW 4 129555668 missense possibly damaging 0.92
R1569:Lck UTSW 4 129555656 missense probably damaging 0.98
R1845:Lck UTSW 4 129558086 missense probably benign 0.00
R2001:Lck UTSW 4 129548937 missense probably benign 0.00
R2141:Lck UTSW 4 129548920 missense probably damaging 1.00
R4737:Lck UTSW 4 129555984 missense possibly damaging 0.93
R5706:Lck UTSW 4 129551638 critical splice acceptor site probably null
R5712:Lck UTSW 4 129556310 missense probably benign
R7023:Lck UTSW 4 129548865 missense possibly damaging 0.89
R7411:Lck UTSW 4 129551970 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGGCTGGGGCTGGTACT -3'
(R):5'- CCTGACTGAGATCCCATACTTAAA -3'

Sequencing Primer
(F):5'- CTGGTACTGGCCCTCTGTG -3'
(R):5'- CCAGCTTGATTTACAGAGTTCCAGG -3'
Posted On2015-10-21