Incidental Mutation 'R4694:Sema3b'
ID 355571
Institutional Source Beutler Lab
Gene Symbol Sema3b
Ensembl Gene ENSMUSG00000057969
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Synonyms SemA, sema5, semaV, Semaa, LUCA-1, SemA
MMRRC Submission 041945-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R4694 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 107597674-107609229 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 107605002 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 26 (P26S)
Ref Sequence ENSEMBL: ENSMUSP00000141928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073448] [ENSMUST00000102529] [ENSMUST00000102530] [ENSMUST00000102531] [ENSMUST00000102532] [ENSMUST00000123926] [ENSMUST00000193180] [ENSMUST00000194433] [ENSMUST00000194606] [ENSMUST00000195057] [ENSMUST00000195662]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000073448
AA Change: P26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073152
Gene: ENSMUSG00000057969
AA Change: P26S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102529
AA Change: P26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099588
Gene: ENSMUSG00000057969
AA Change: P26S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102530
AA Change: P26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099589
Gene: ENSMUSG00000057969
AA Change: P26S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102531
AA Change: P26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099590
Gene: ENSMUSG00000057969
AA Change: P26S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102532
AA Change: P26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099591
Gene: ENSMUSG00000057969
AA Change: P26S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123926
AA Change: P26S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137952
Gene: ENSMUSG00000057969
AA Change: P26S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193180
AA Change: P26S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141726
Gene: ENSMUSG00000057969
AA Change: P26S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 148 8.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193551
Predicted Effect probably benign
Transcript: ENSMUST00000194433
AA Change: P26S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141403
Gene: ENSMUSG00000057969
AA Change: P26S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 172 3.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194606
AA Change: P26S

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000195057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195472
Predicted Effect probably benign
Transcript: ENSMUST00000195662
AA Change: P26S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141614
Gene: ENSMUSG00000057969
AA Change: P26S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 137 8.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that belongs to the class 3 semaphorin/collapsin family. Members of this family play a role in growth cone guidance during neurogenesis. The encoded protein inhibits axonal extension. This protein is thought to be an osteoblast protein that regulates bone mass and affects skeletal homeostasis. A similar gene in humans functions as a tumor suppressor gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile with no obvious pathological abnormalities. Mice homozygous for a second knock-out allele exhibit improper positioning of a major brain commissural projection, the anterior commissure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,672,158 F258Y probably damaging Het
Adamtsl4 C T 3: 95,679,745 R765H probably damaging Het
Bicd1 T A 6: 149,409,553 L42Q probably damaging Het
Cacna1e C T 1: 154,437,266 probably null Het
Capn1 T A 19: 5,994,731 K504* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep350 T C 1: 155,928,586 K917R probably damaging Het
Cp A T 3: 19,974,885 T509S probably benign Het
Cyp2d10 T C 15: 82,404,483 D266G probably damaging Het
Dhodh C G 8: 109,606,416 R7P probably damaging Het
Dmxl2 A G 9: 54,446,905 L419P probably benign Het
Epb41l4b A T 4: 57,019,875 M84K probably benign Het
Fbln7 A G 2: 128,880,425 probably null Het
Fbxw11 C T 11: 32,642,820 probably benign Het
Flnc C A 6: 29,443,448 P543T probably damaging Het
Gm13103 T C 4: 143,852,960 S372P probably damaging Het
Grid1 T C 14: 35,026,780 S186P probably damaging Het
Hcfc2 C T 10: 82,723,700 T382M probably damaging Het
Hdac9 G T 12: 34,437,247 L73I probably damaging Het
Hnrnpa2b1 A T 6: 51,464,183 D302E probably damaging Het
Ifi204 C T 1: 173,749,259 C592Y probably damaging Het
Jph1 T A 1: 16,997,505 I653F probably damaging Het
Kcnj3 A G 2: 55,594,906 K339E probably benign Het
Kcp G A 6: 29,493,197 T838I probably benign Het
Krtap26-1 A T 16: 88,647,220 V171E possibly damaging Het
Lck G T 4: 129,548,972 N452K possibly damaging Het
Madd A G 2: 91,160,328 L1134S probably damaging Het
Mafk T C 5: 139,800,493 S149P probably damaging Het
Man1c1 T C 4: 134,703,189 D94G probably benign Het
Me2 T A 18: 73,801,859 M38L probably benign Het
Muc2 A C 7: 141,752,345 D257A probably damaging Het
Myh11 T C 16: 14,200,702 K1927E probably damaging Het
Naaladl1 C T 19: 6,108,890 P324S probably damaging Het
Ndufa10 T C 1: 92,452,102 E303G probably benign Het
Nedd1 C T 10: 92,719,582 V14I probably benign Het
Nwd1 T G 8: 72,667,330 V407G probably damaging Het
Olfr1136 T A 2: 87,693,760 T41S probably benign Het
Olfr132 A C 17: 38,130,857 C112G probably damaging Het
Olfr32 T A 2: 90,138,249 K297* probably null Het
Olfr726 T C 14: 50,084,019 I221V probably benign Het
Olfr847 A G 9: 19,375,398 L161P probably damaging Het
Pgrmc2 T C 3: 41,070,405 D144G probably damaging Het
Ppp3cb T C 14: 20,501,515 N516S probably benign Het
Prelp A G 1: 133,914,747 M220T probably damaging Het
Prss36 A G 7: 127,935,615 W465R probably damaging Het
Pth2r C A 1: 65,336,761 F59L probably benign Het
Rab20 C T 8: 11,454,485 G72R probably damaging Het
Rab4a G T 8: 123,829,030 G49W probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rock1 A T 18: 10,136,152 Y178* probably null Het
Scaf8 C A 17: 3,197,404 L1001I probably damaging Het
Slc23a1 A G 18: 35,619,580 L548P probably damaging Het
Sncaip A C 18: 52,906,557 T548P probably benign Het
Stpg2 C T 3: 139,317,416 P398S possibly damaging Het
Stpg3 A C 2: 25,213,297 V260G probably damaging Het
Tbc1d9 T A 8: 83,234,246 F242I probably damaging Het
Tnks1bp1 G A 2: 85,071,722 R992Q probably damaging Het
Tom1l1 T G 11: 90,646,849 H394P possibly damaging Het
Topors T G 4: 40,261,442 N614T possibly damaging Het
Trank1 A T 9: 111,392,061 Q2622L probably benign Het
Trub2 A G 2: 29,778,846 S186P probably damaging Het
Unc13c T A 9: 73,572,354 H1756L probably benign Het
Vmn1r9 A T 6: 57,071,329 I130F probably benign Het
Wdr72 A T 9: 74,179,555 I602F probably damaging Het
Zfand3 T A 17: 30,135,388 F60I possibly damaging Het
Zfp946 G A 17: 22,455,711 G482E probably benign Het
Other mutations in Sema3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Sema3b APN 9 107604041 critical splice donor site probably null
IGL02750:Sema3b APN 9 107603164 missense probably benign 0.02
IGL02878:Sema3b APN 9 107600993 missense probably damaging 0.97
IGL03004:Sema3b APN 9 107602915 missense possibly damaging 0.72
IGL03026:Sema3b APN 9 107602063 missense probably damaging 1.00
IGL03129:Sema3b APN 9 107599796 unclassified probably benign
IGL03334:Sema3b APN 9 107604077 missense probably damaging 1.00
R0373:Sema3b UTSW 9 107602918 missense probably benign 0.05
R0384:Sema3b UTSW 9 107600966 missense probably damaging 1.00
R0883:Sema3b UTSW 9 107604156 missense possibly damaging 0.77
R3916:Sema3b UTSW 9 107600458 missense probably damaging 1.00
R3971:Sema3b UTSW 9 107600368 missense probably benign
R4212:Sema3b UTSW 9 107603398 missense probably damaging 1.00
R4647:Sema3b UTSW 9 107599051 missense possibly damaging 0.79
R4791:Sema3b UTSW 9 107603813 missense probably damaging 1.00
R4853:Sema3b UTSW 9 107602067 splice site probably null
R5305:Sema3b UTSW 9 107603337 missense probably null 1.00
R5487:Sema3b UTSW 9 107600962 missense probably damaging 1.00
R5745:Sema3b UTSW 9 107601429 missense probably damaging 0.98
R5751:Sema3b UTSW 9 107599714 missense probably benign
R6086:Sema3b UTSW 9 107600848 missense probably damaging 1.00
R6306:Sema3b UTSW 9 107600920 missense possibly damaging 0.88
R6594:Sema3b UTSW 9 107598826 missense probably benign 0.01
R6816:Sema3b UTSW 9 107600350 missense probably benign 0.08
R6833:Sema3b UTSW 9 107603316 missense probably benign 0.04
R7320:Sema3b UTSW 9 107600942 missense probably benign
R7448:Sema3b UTSW 9 107602963 missense probably damaging 1.00
R7687:Sema3b UTSW 9 107603814 missense probably damaging 1.00
R8839:Sema3b UTSW 9 107601353 unclassified probably benign
R9090:Sema3b UTSW 9 107598955 missense probably damaging 1.00
R9123:Sema3b UTSW 9 107600974 missense possibly damaging 0.64
R9271:Sema3b UTSW 9 107598955 missense probably damaging 1.00
R9442:Sema3b UTSW 9 107601758 critical splice donor site probably null
R9682:Sema3b UTSW 9 107603814 missense probably damaging 1.00
R9755:Sema3b UTSW 9 107601585 missense probably damaging 1.00
Z1088:Sema3b UTSW 9 107599034 splice site probably null
Z1176:Sema3b UTSW 9 107599639 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGGTTAACTGGAGATGGCC -3'
(R):5'- AATCTGATCCCTTGGGACTCC -3'

Sequencing Primer
(F):5'- CTGGAGATGGCCCAAGAAAACC -3'
(R):5'- TCTGCTTTGCTGCGGAC -3'
Posted On 2015-10-21