Incidental Mutation 'R4694:Hcfc2'
ID355573
Institutional Source Beutler Lab
Gene Symbol Hcfc2
Ensembl Gene ENSMUSG00000020246
Gene Namehost cell factor C2
Synonyms1700129L13Rik
MMRRC Submission 041945-MU
Accession Numbers

Genbank: NM_001081218; MGI: 1915183

Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4694 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location82696160-82742428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82723700 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 382 (T382M)
Ref Sequence ENSEMBL: ENSMUSP00000020478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020478] [ENSMUST00000160681]
Predicted Effect probably damaging
Transcript: ENSMUST00000020478
AA Change: T382M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020478
Gene: ENSMUSG00000020246
AA Change: T382M

DomainStartEndE-ValueType
Pfam:Kelch_1 22 60 2.1e-6 PFAM
Pfam:Kelch_5 68 106 1.1e-6 PFAM
Pfam:Kelch_3 81 135 8.8e-7 PFAM
Pfam:Kelch_5 186 230 8.4e-7 PFAM
Pfam:Kelch_3 206 253 1.6e-11 PFAM
Pfam:Kelch_1 244 302 7.5e-9 PFAM
Pfam:Kelch_3 254 323 3.4e-7 PFAM
Pfam:Kelch_5 312 356 1.4e-6 PFAM
FN3 357 591 8.43e-9 SMART
FN3 607 703 6.06e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160681
SMART Domains Protein: ENSMUSP00000124489
Gene: ENSMUSG00000020246

DomainStartEndE-ValueType
FN3 52 131 1.22e1 SMART
FN3 147 243 6.06e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null or severely hypomorphic allele exhibit reduced poly(I:C)-mediated TLR3 signaling and increased mortality following viral infection. [provided by MGI curators]
Allele List at MGI

none known

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,672,158 F258Y probably damaging Het
Adamtsl4 C T 3: 95,679,745 R765H probably damaging Het
Bicd1 T A 6: 149,409,553 L42Q probably damaging Het
Cacna1e C T 1: 154,437,266 probably null Het
Capn1 T A 19: 5,994,731 K504* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep350 T C 1: 155,928,586 K917R probably damaging Het
Cp A T 3: 19,974,885 T509S probably benign Het
Cyp2d10 T C 15: 82,404,483 D266G probably damaging Het
Dhodh C G 8: 109,606,416 R7P probably damaging Het
Dmxl2 A G 9: 54,446,905 L419P probably benign Het
Epb41l4b A T 4: 57,019,875 M84K probably benign Het
Fbln7 A G 2: 128,880,425 probably null Het
Fbxw11 C T 11: 32,642,820 probably benign Het
Flnc C A 6: 29,443,448 P543T probably damaging Het
Gm13103 T C 4: 143,852,960 S372P probably damaging Het
Grid1 T C 14: 35,026,780 S186P probably damaging Het
Hdac9 G T 12: 34,437,247 L73I probably damaging Het
Hnrnpa2b1 A T 6: 51,464,183 D302E probably damaging Het
Ifi204 C T 1: 173,749,259 C592Y probably damaging Het
Jph1 T A 1: 16,997,505 I653F probably damaging Het
Kcnj3 A G 2: 55,594,906 K339E probably benign Het
Kcp G A 6: 29,493,197 T838I probably benign Het
Krtap26-1 A T 16: 88,647,220 V171E possibly damaging Het
Lck G T 4: 129,548,972 N452K possibly damaging Het
Madd A G 2: 91,160,328 L1134S probably damaging Het
Mafk T C 5: 139,800,493 S149P probably damaging Het
Man1c1 T C 4: 134,703,189 D94G probably benign Het
Me2 T A 18: 73,801,859 M38L probably benign Het
Muc2 A C 7: 141,752,345 D257A probably damaging Het
Myh11 T C 16: 14,200,702 K1927E probably damaging Het
Naaladl1 C T 19: 6,108,890 P324S probably damaging Het
Ndufa10 T C 1: 92,452,102 E303G probably benign Het
Nedd1 C T 10: 92,719,582 V14I probably benign Het
Nwd1 T G 8: 72,667,330 V407G probably damaging Het
Olfr1136 T A 2: 87,693,760 T41S probably benign Het
Olfr132 A C 17: 38,130,857 C112G probably damaging Het
Olfr32 T A 2: 90,138,249 K297* probably null Het
Olfr726 T C 14: 50,084,019 I221V probably benign Het
Olfr847 A G 9: 19,375,398 L161P probably damaging Het
Pgrmc2 T C 3: 41,070,405 D144G probably damaging Het
Ppp3cb T C 14: 20,501,515 N516S probably benign Het
Prelp A G 1: 133,914,747 M220T probably damaging Het
Prss36 A G 7: 127,935,615 W465R probably damaging Het
Pth2r C A 1: 65,336,761 F59L probably benign Het
Rab20 C T 8: 11,454,485 G72R probably damaging Het
Rab4a G T 8: 123,829,030 G49W probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rock1 A T 18: 10,136,152 Y178* probably null Het
Scaf8 C A 17: 3,197,404 L1001I probably damaging Het
Sema3b G A 9: 107,605,002 P26S probably benign Het
Slc23a1 A G 18: 35,619,580 L548P probably damaging Het
Sncaip A C 18: 52,906,557 T548P probably benign Het
Stpg2 C T 3: 139,317,416 P398S possibly damaging Het
Stpg3 A C 2: 25,213,297 V260G probably damaging Het
Tbc1d9 T A 8: 83,234,246 F242I probably damaging Het
Tnks1bp1 G A 2: 85,071,722 R992Q probably damaging Het
Tom1l1 T G 11: 90,646,849 H394P possibly damaging Het
Topors T G 4: 40,261,442 N614T possibly damaging Het
Trank1 A T 9: 111,392,061 Q2622L probably benign Het
Trub2 A G 2: 29,778,846 S186P probably damaging Het
Unc13c T A 9: 73,572,354 H1756L probably benign Het
Vmn1r9 A T 6: 57,071,329 I130F probably benign Het
Wdr72 A T 9: 74,179,555 I602F probably damaging Het
Zfand3 T A 17: 30,135,388 F60I possibly damaging Het
Zfp946 G A 17: 22,455,711 G482E probably benign Het
Other mutations in Hcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hcfc2 APN 10 82741278 splice site probably null
IGL01799:Hcfc2 APN 10 82700991 missense probably damaging 1.00
IGL01916:Hcfc2 APN 10 82734383 missense possibly damaging 0.94
IGL02150:Hcfc2 APN 10 82710018 missense probably damaging 1.00
IGL02378:Hcfc2 APN 10 82709071 missense possibly damaging 0.64
IGL02580:Hcfc2 APN 10 82728422 missense probably benign 0.00
IGL02641:Hcfc2 APN 10 82702549 missense probably damaging 1.00
Backstabbing UTSW 10 82711825 splice site probably null
feckless UTSW 10 82712061 missense probably damaging 1.00
Minions UTSW 10 82739245 missense probably damaging 1.00
scaffold UTSW 10 82738408 missense probably damaging 1.00
R0380:Hcfc2 UTSW 10 82728438 splice site probably benign
R0528:Hcfc2 UTSW 10 82739245 missense probably damaging 1.00
R0534:Hcfc2 UTSW 10 82738408 missense probably damaging 1.00
R1646:Hcfc2 UTSW 10 82701027 missense probably damaging 1.00
R1903:Hcfc2 UTSW 10 82702558 missense probably damaging 0.98
R1939:Hcfc2 UTSW 10 82702450 missense probably damaging 0.99
R2014:Hcfc2 UTSW 10 82738980 missense probably benign 0.23
R2015:Hcfc2 UTSW 10 82738980 missense probably benign 0.23
R2571:Hcfc2 UTSW 10 82709023 missense probably damaging 1.00
R4540:Hcfc2 UTSW 10 82732647 missense probably benign 0.10
R4735:Hcfc2 UTSW 10 82712080 missense probably damaging 1.00
R4833:Hcfc2 UTSW 10 82709146 missense probably null 0.01
R6837:Hcfc2 UTSW 10 82739196 missense probably damaging 0.96
R7268:Hcfc2 UTSW 10 82709012 nonsense probably null
R7683:Hcfc2 UTSW 10 82699229 missense probably benign 0.00
R7733:Hcfc2 UTSW 10 82739179 missense probably benign 0.00
R7742:Hcfc2 UTSW 10 82711825 splice site probably null
V3553:Hcfc2 UTSW 10 82712061 missense probably damaging 1.00
X0022:Hcfc2 UTSW 10 82709967 missense probably damaging 0.99
Z1176:Hcfc2 UTSW 10 82699172 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCAGTAAGCAGTGCAGTGC -3'
(R):5'- AGGACAGGTTAAATCCCCGC -3'

Sequencing Primer
(F):5'- GTGCTCATCACTGGAGATCTCAAAG -3'
(R):5'- AGGTTAAATCCCCGCATCGTC -3'
Posted On2015-10-21