Incidental Mutation 'R4694:Grid1'
ID355579
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
MMRRC Submission 041945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4694 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35026780 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 186 (S186P)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect probably damaging
Transcript: ENSMUST00000043349
AA Change: S186P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: S186P

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,672,158 F258Y probably damaging Het
Adamtsl4 C T 3: 95,679,745 R765H probably damaging Het
Bicd1 T A 6: 149,409,553 L42Q probably damaging Het
Cacna1e C T 1: 154,437,266 probably null Het
Capn1 T A 19: 5,994,731 K504* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep350 T C 1: 155,928,586 K917R probably damaging Het
Cp A T 3: 19,974,885 T509S probably benign Het
Cyp2d10 T C 15: 82,404,483 D266G probably damaging Het
Dhodh C G 8: 109,606,416 R7P probably damaging Het
Dmxl2 A G 9: 54,446,905 L419P probably benign Het
Epb41l4b A T 4: 57,019,875 M84K probably benign Het
Fbln7 A G 2: 128,880,425 probably null Het
Fbxw11 C T 11: 32,642,820 probably benign Het
Flnc C A 6: 29,443,448 P543T probably damaging Het
Gm13103 T C 4: 143,852,960 S372P probably damaging Het
Hcfc2 C T 10: 82,723,700 T382M probably damaging Het
Hdac9 G T 12: 34,437,247 L73I probably damaging Het
Hnrnpa2b1 A T 6: 51,464,183 D302E probably damaging Het
Ifi204 C T 1: 173,749,259 C592Y probably damaging Het
Jph1 T A 1: 16,997,505 I653F probably damaging Het
Kcnj3 A G 2: 55,594,906 K339E probably benign Het
Kcp G A 6: 29,493,197 T838I probably benign Het
Krtap26-1 A T 16: 88,647,220 V171E possibly damaging Het
Lck G T 4: 129,548,972 N452K possibly damaging Het
Madd A G 2: 91,160,328 L1134S probably damaging Het
Mafk T C 5: 139,800,493 S149P probably damaging Het
Man1c1 T C 4: 134,703,189 D94G probably benign Het
Me2 T A 18: 73,801,859 M38L probably benign Het
Muc2 A C 7: 141,752,345 D257A probably damaging Het
Myh11 T C 16: 14,200,702 K1927E probably damaging Het
Naaladl1 C T 19: 6,108,890 P324S probably damaging Het
Ndufa10 T C 1: 92,452,102 E303G probably benign Het
Nedd1 C T 10: 92,719,582 V14I probably benign Het
Nwd1 T G 8: 72,667,330 V407G probably damaging Het
Olfr1136 T A 2: 87,693,760 T41S probably benign Het
Olfr132 A C 17: 38,130,857 C112G probably damaging Het
Olfr32 T A 2: 90,138,249 K297* probably null Het
Olfr726 T C 14: 50,084,019 I221V probably benign Het
Olfr847 A G 9: 19,375,398 L161P probably damaging Het
Pgrmc2 T C 3: 41,070,405 D144G probably damaging Het
Ppp3cb T C 14: 20,501,515 N516S probably benign Het
Prelp A G 1: 133,914,747 M220T probably damaging Het
Prss36 A G 7: 127,935,615 W465R probably damaging Het
Pth2r C A 1: 65,336,761 F59L probably benign Het
Rab20 C T 8: 11,454,485 G72R probably damaging Het
Rab4a G T 8: 123,829,030 G49W probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rock1 A T 18: 10,136,152 Y178* probably null Het
Scaf8 C A 17: 3,197,404 L1001I probably damaging Het
Sema3b G A 9: 107,605,002 P26S probably benign Het
Slc23a1 A G 18: 35,619,580 L548P probably damaging Het
Sncaip A C 18: 52,906,557 T548P probably benign Het
Stpg2 C T 3: 139,317,416 P398S possibly damaging Het
Stpg3 A C 2: 25,213,297 V260G probably damaging Het
Tbc1d9 T A 8: 83,234,246 F242I probably damaging Het
Tnks1bp1 G A 2: 85,071,722 R992Q probably damaging Het
Tom1l1 T G 11: 90,646,849 H394P possibly damaging Het
Topors T G 4: 40,261,442 N614T possibly damaging Het
Trank1 A T 9: 111,392,061 Q2622L probably benign Het
Trub2 A G 2: 29,778,846 S186P probably damaging Het
Unc13c T A 9: 73,572,354 H1756L probably benign Het
Vmn1r9 A T 6: 57,071,329 I130F probably benign Het
Wdr72 A T 9: 74,179,555 I602F probably damaging Het
Zfand3 T A 17: 30,135,388 F60I possibly damaging Het
Zfp946 G A 17: 22,455,711 G482E probably benign Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGGGGCTGGATACTGATG -3'
(R):5'- CATTGATGAAGGAGTGCGCC -3'

Sequencing Primer
(F):5'- GCACCATGCTCTGAATAAGTG -3'
(R):5'- AAGGAGTGCGCCCCCTG -3'
Posted On2015-10-21