Incidental Mutation 'R4694:Capn1'
ID355596
Institutional Source Beutler Lab
Gene Symbol Capn1
Ensembl Gene ENSMUSG00000024942
Gene Namecalpain 1
Synonymsmu-calpin, Capa1, Capa-1
MMRRC Submission 041945-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4694 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5988546-6015825 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 5994731 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 504 (K504*)
Ref Sequence ENSEMBL: ENSMUSP00000127498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000164843]
Predicted Effect probably null
Transcript: ENSMUST00000025891
AA Change: K504*
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942
AA Change: K504*

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164843
AA Change: K504*
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942
AA Change: K504*

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a mutation of this gene exhibit decreased platelet aggregation and defective clot retraction although bleeding times remain similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,672,158 F258Y probably damaging Het
Adamtsl4 C T 3: 95,679,745 R765H probably damaging Het
Bicd1 T A 6: 149,409,553 L42Q probably damaging Het
Cacna1e C T 1: 154,437,266 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep350 T C 1: 155,928,586 K917R probably damaging Het
Cp A T 3: 19,974,885 T509S probably benign Het
Cyp2d10 T C 15: 82,404,483 D266G probably damaging Het
Dhodh C G 8: 109,606,416 R7P probably damaging Het
Dmxl2 A G 9: 54,446,905 L419P probably benign Het
Epb41l4b A T 4: 57,019,875 M84K probably benign Het
Fbln7 A G 2: 128,880,425 probably null Het
Fbxw11 C T 11: 32,642,820 probably benign Het
Flnc C A 6: 29,443,448 P543T probably damaging Het
Gm13103 T C 4: 143,852,960 S372P probably damaging Het
Grid1 T C 14: 35,026,780 S186P probably damaging Het
Hcfc2 C T 10: 82,723,700 T382M probably damaging Het
Hdac9 G T 12: 34,437,247 L73I probably damaging Het
Hnrnpa2b1 A T 6: 51,464,183 D302E probably damaging Het
Ifi204 C T 1: 173,749,259 C592Y probably damaging Het
Jph1 T A 1: 16,997,505 I653F probably damaging Het
Kcnj3 A G 2: 55,594,906 K339E probably benign Het
Kcp G A 6: 29,493,197 T838I probably benign Het
Krtap26-1 A T 16: 88,647,220 V171E possibly damaging Het
Lck G T 4: 129,548,972 N452K possibly damaging Het
Madd A G 2: 91,160,328 L1134S probably damaging Het
Mafk T C 5: 139,800,493 S149P probably damaging Het
Man1c1 T C 4: 134,703,189 D94G probably benign Het
Me2 T A 18: 73,801,859 M38L probably benign Het
Muc2 A C 7: 141,752,345 D257A probably damaging Het
Myh11 T C 16: 14,200,702 K1927E probably damaging Het
Naaladl1 C T 19: 6,108,890 P324S probably damaging Het
Ndufa10 T C 1: 92,452,102 E303G probably benign Het
Nedd1 C T 10: 92,719,582 V14I probably benign Het
Nwd1 T G 8: 72,667,330 V407G probably damaging Het
Olfr1136 T A 2: 87,693,760 T41S probably benign Het
Olfr132 A C 17: 38,130,857 C112G probably damaging Het
Olfr32 T A 2: 90,138,249 K297* probably null Het
Olfr726 T C 14: 50,084,019 I221V probably benign Het
Olfr847 A G 9: 19,375,398 L161P probably damaging Het
Pgrmc2 T C 3: 41,070,405 D144G probably damaging Het
Ppp3cb T C 14: 20,501,515 N516S probably benign Het
Prelp A G 1: 133,914,747 M220T probably damaging Het
Prss36 A G 7: 127,935,615 W465R probably damaging Het
Pth2r C A 1: 65,336,761 F59L probably benign Het
Rab20 C T 8: 11,454,485 G72R probably damaging Het
Rab4a G T 8: 123,829,030 G49W probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rock1 A T 18: 10,136,152 Y178* probably null Het
Scaf8 C A 17: 3,197,404 L1001I probably damaging Het
Sema3b G A 9: 107,605,002 P26S probably benign Het
Slc23a1 A G 18: 35,619,580 L548P probably damaging Het
Sncaip A C 18: 52,906,557 T548P probably benign Het
Stpg2 C T 3: 139,317,416 P398S possibly damaging Het
Stpg3 A C 2: 25,213,297 V260G probably damaging Het
Tbc1d9 T A 8: 83,234,246 F242I probably damaging Het
Tnks1bp1 G A 2: 85,071,722 R992Q probably damaging Het
Tom1l1 T G 11: 90,646,849 H394P possibly damaging Het
Topors T G 4: 40,261,442 N614T possibly damaging Het
Trank1 A T 9: 111,392,061 Q2622L probably benign Het
Trub2 A G 2: 29,778,846 S186P probably damaging Het
Unc13c T A 9: 73,572,354 H1756L probably benign Het
Vmn1r9 A T 6: 57,071,329 I130F probably benign Het
Wdr72 A T 9: 74,179,555 I602F probably damaging Het
Zfand3 T A 17: 30,135,388 F60I possibly damaging Het
Zfp946 G A 17: 22,455,711 G482E probably benign Het
Other mutations in Capn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Capn1 APN 19 6007269 missense probably damaging 1.00
IGL01314:Capn1 APN 19 5989984 splice site probably benign
R0044:Capn1 UTSW 19 6014343 missense probably benign 0.03
R1496:Capn1 UTSW 19 6007498 critical splice donor site probably null
R1646:Capn1 UTSW 19 5997730 missense probably benign
R1852:Capn1 UTSW 19 6009103 missense possibly damaging 0.95
R1924:Capn1 UTSW 19 5990056 splice site probably null
R2006:Capn1 UTSW 19 5991583 missense probably damaging 1.00
R2109:Capn1 UTSW 19 6014358 missense probably benign 0.01
R3704:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3705:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3830:Capn1 UTSW 19 5994847 missense probably damaging 1.00
R4664:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4665:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4666:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4745:Capn1 UTSW 19 5993916 missense probably benign 0.12
R5103:Capn1 UTSW 19 6009110 missense probably damaging 1.00
R5149:Capn1 UTSW 19 5990334 splice site probably null
R5569:Capn1 UTSW 19 6013660 missense probably benign
R5636:Capn1 UTSW 19 6014442 missense probably benign 0.22
R5906:Capn1 UTSW 19 6011421 missense possibly damaging 0.90
R5907:Capn1 UTSW 19 5997797 missense probably benign
R7038:Capn1 UTSW 19 6014319 missense probably benign 0.23
R7091:Capn1 UTSW 19 5991556 missense possibly damaging 0.64
R7307:Capn1 UTSW 19 5993908 missense possibly damaging 0.91
R7592:Capn1 UTSW 19 6014439 missense probably benign 0.00
R7779:Capn1 UTSW 19 5994086 missense probably benign
R8514:Capn1 UTSW 19 5997824 missense probably damaging 0.98
R8708:Capn1 UTSW 19 6011298 missense probably damaging 1.00
Z1176:Capn1 UTSW 19 6014278 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCGAATACCAGGGGAGAC -3'
(R):5'- GGGCCAGCATCTAAAGGTAG -3'

Sequencing Primer
(F):5'- GACCACGTACCTCATCAGGGAG -3'
(R):5'- TAGACAGAGTGGACCCTGC -3'
Posted On2015-10-21