Mutagenetix > Incidental Mutations

Incidental Mutation 'R4695:Mrps9'

355599

Institutional Source

Beutler Lab

Gene Symbol

Mrps9

Ensembl Gene

ENSMUSG00000060679

Gene Name

mitochondrial ribosomal protein S9

Synonyms

MMRRC Submission

042016-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.923) question?

Stock #

R4695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42851233-42905683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 42862515 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 61 (V61D)

Ref Sequence

ENSEMBL: ENSMUSP00000056855 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057208]

AlphaFold

Q9D7N3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057208
AA Change: V61D

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000056855
Gene: ENSMUSG00000060679
AA Change: V61D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	194	207	N/A	INTRINSIC
Pfam:Ribosomal_S9	268	390	7.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104260

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187414

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188174

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts10	T	A	17: 33,531,739	M251K	possibly damaging	Het
Adcy2	A	T	13: 68,727,843	H513Q	possibly damaging	Het
Ahctf1	A	G	1: 179,753,054	L1861P	possibly damaging	Het
Apc2	C	A	10: 80,311,043	R615S	probably damaging	Het
Arhgap45	A	C	10: 80,025,530	D509A	probably damaging	Het
Atp6v1c2	T	C	12: 17,301,207	T108A	probably benign	Het
Blm	T	A	7: 80,494,228	D821V	probably damaging	Het
C3	T	A	17: 57,221,057	I721L	probably benign	Het
Ccdc13	A	T	9: 121,820,760	V207E	probably damaging	Het
Ccndbp1	C	T	2: 121,014,727		probably benign	Het
Cd180	A	C	13: 102,705,760	Q438P	probably benign	Het
Cd248	C	T	19: 5,068,445	T107M	probably damaging	Het
Cdan1	G	A	2: 120,728,383	R445C	probably damaging	Het
Cic	C	A	7: 25,273,588	H915N	possibly damaging	Het
Cox8c	T	C	12: 102,899,483	S40P	possibly damaging	Het
Cyp2d34	A	T	15: 82,616,891	C347S	probably benign	Het
Dhx30	A	T	9: 110,085,288	F974I	probably damaging	Het
Dlec1	A	T	9: 119,143,153	T1414S	probably benign	Het
Dlg2	C	A	7: 92,437,962		probably null	Het
Dzip1l	T	A	9: 99,647,205	M329K	probably benign	Het
Dzip3	A	T	16: 48,951,561	L582I	probably damaging	Het
Emilin2	T	C	17: 71,252,778	Y1068C	probably damaging	Het
Fam221b	T	A	4: 43,659,622		probably null	Het
Fbxw22	A	G	9: 109,378,871	I444T	probably damaging	Het
Flnc	T	A	6: 29,440,429	N245K	probably damaging	Het
Fnip1	T	A	11: 54,499,419	I380N	probably damaging	Het
Gbf1	C	T	19: 46,259,167	R181*	probably null	Het
Igkv6-17	T	A	6: 70,371,502	F12I	probably benign	Het
Itln1	C	A	1: 171,531,077	G174V	probably damaging	Het
Lrrc52	A	G	1: 167,466,091		probably null	Het
Matn2	A	G	15: 34,402,925	Y432C	probably damaging	Het
Metap1d	A	G	2: 71,524,961	*336W	probably null	Het
Mgam2-ps	T	A	6: 40,802,555		noncoding transcript	Het
Myh7b	T	C	2: 155,614,177	Y161H	probably damaging	Het
Myh9	T	A	15: 77,768,853	D1428V	probably damaging	Het
N4bp3	A	T	11: 51,644,479		probably null	Het
Nat9	T	A	11: 115,184,590	Q75L	probably benign	Het
Nop2	T	C	6: 125,144,556	V767A	probably benign	Het
Ntrk2	A	G	13: 59,126,493	K728E	probably damaging	Het
Olfr497	G	A	7: 108,422,989	M139I	probably benign	Het
Olfr558	T	G	7: 102,709,557	C99W	probably damaging	Het
Olfr836	T	A	9: 19,121,010	H15Q	probably null	Het
Oraov1	T	C	7: 144,928,978		probably null	Het
Pcdhgb2	A	G	18: 37,692,322	T789A	probably benign	Het
Pcyt2	T	C	11: 120,611,174	D321G	probably benign	Het
Rad9a	G	A	19: 4,200,561	R85C	probably damaging	Het
Rbbp8	A	T	18: 11,721,782	K355*	probably null	Het
Rhag	T	C	17: 40,836,467	Y407H	probably damaging	Het
Robo4	G	A	9: 37,403,199	V161M	probably damaging	Het
Rpl27-ps3	C	A	18: 6,332,922	N97K	probably benign	Het
Slc45a4	A	G	15: 73,582,075	I691T	possibly damaging	Het
Slc9a9	A	T	9: 94,936,449		probably benign	Het
Spata5	T	G	3: 37,458,325	F713C	probably damaging	Het
Stard13	A	G	5: 151,060,815	F619L	probably benign	Het
Stt3b	A	T	9: 115,254,794	V438E	probably damaging	Het
Tacr3	C	T	3: 134,829,421	T50I	probably benign	Het
Tacr3	G	T	3: 134,929,929	C298F	probably damaging	Het
Taok3	C	T	5: 117,228,066	T394M	probably benign	Het
Tctex1d1	T	A	4: 103,004,229	I136K	probably damaging	Het
Tgfb1i1	A	G	7: 128,249,176	D128G	probably damaging	Het
Tgfbr3l	G	T	8: 4,250,574	V251L	probably benign	Het
Tom1l2	C	G	11: 60,270,433	R84P	probably damaging	Het
Top3a	A	G	11: 60,742,412	S953P	probably benign	Het
Trappc10	T	C	10: 78,197,863	K957E	probably damaging	Het
Ttn	T	A	2: 76,735,324	E28228V	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Vdr	A	T	15: 97,858,920		probably null	Het
Zfp42	A	T	8: 43,296,131	L111Q	probably damaging	Het

Other mutations in Mrps9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Mrps9	APN	1	42905459	missense	probably damaging	1.00
IGL01134:Mrps9	APN	1	42903397	missense	probably damaging	0.97
IGL01557:Mrps9	APN	1	42851350	missense	probably benign
IGL02541:Mrps9	APN	1	42862654	splice site	probably null
PIT4402001:Mrps9	UTSW	1	42896098	missense	probably benign	0.10
R0598:Mrps9	UTSW	1	42905417	missense	probably damaging	1.00
R1718:Mrps9	UTSW	1	42903399	missense	probably damaging	1.00
R4195:Mrps9	UTSW	1	42901094	intron	probably benign
R4196:Mrps9	UTSW	1	42901094	intron	probably benign
R4840:Mrps9	UTSW	1	42898415	intron	probably benign
R5033:Mrps9	UTSW	1	42895331	splice site	probably null
R5489:Mrps9	UTSW	1	42898433	splice site	probably benign
R5876:Mrps9	UTSW	1	42895378	missense	probably damaging	0.99
R6891:Mrps9	UTSW	1	42905413	missense	probably damaging	1.00
R7015:Mrps9	UTSW	1	42898546	missense	probably benign	0.04
R7940:Mrps9	UTSW	1	42862648	missense	probably damaging	0.98
R8679:Mrps9	UTSW	1	42879755	missense	probably damaging	0.99
R9117:Mrps9	UTSW	1	42903377	missense	probably benign	0.22
Z1177:Mrps9	UTSW	1	42899458	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GAGCAGAGGTTATGTCTAGCAC -3'
(R):5'- AAGAGCAGTGCTGTTCAGAC -3'

Sequencing Primer
(F):5'- AGCAGAGGTTATGTCTAGCACTTTGG -3'
(R):5'- AGTGCTGTTCAGACCCACAG -3'

Posted On

2015-10-21