Incidental Mutation 'R4695:Blm'
ID355622
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene NameBloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 042016-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4695 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80454733-80535119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80494228 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 821 (D821V)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
Predicted Effect probably damaging
Transcript: ENSMUST00000081314
AA Change: D818V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: D818V

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170315
AA Change: D821V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: D821V

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205263
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,531,739 M251K possibly damaging Het
Adcy2 A T 13: 68,727,843 H513Q possibly damaging Het
Ahctf1 A G 1: 179,753,054 L1861P possibly damaging Het
Apc2 C A 10: 80,311,043 R615S probably damaging Het
Arhgap45 A C 10: 80,025,530 D509A probably damaging Het
Atp6v1c2 T C 12: 17,301,207 T108A probably benign Het
C3 T A 17: 57,221,057 I721L probably benign Het
Ccdc13 A T 9: 121,820,760 V207E probably damaging Het
Ccndbp1 C T 2: 121,014,727 probably benign Het
Cd180 A C 13: 102,705,760 Q438P probably benign Het
Cd248 C T 19: 5,068,445 T107M probably damaging Het
Cdan1 G A 2: 120,728,383 R445C probably damaging Het
Cic C A 7: 25,273,588 H915N possibly damaging Het
Cox8c T C 12: 102,899,483 S40P possibly damaging Het
Cyp2d34 A T 15: 82,616,891 C347S probably benign Het
Dhx30 A T 9: 110,085,288 F974I probably damaging Het
Dlec1 A T 9: 119,143,153 T1414S probably benign Het
Dlg2 C A 7: 92,437,962 probably null Het
Dzip1l T A 9: 99,647,205 M329K probably benign Het
Dzip3 A T 16: 48,951,561 L582I probably damaging Het
Emilin2 T C 17: 71,252,778 Y1068C probably damaging Het
Fam221b T A 4: 43,659,622 probably null Het
Fbxw22 A G 9: 109,378,871 I444T probably damaging Het
Flnc T A 6: 29,440,429 N245K probably damaging Het
Fnip1 T A 11: 54,499,419 I380N probably damaging Het
Gbf1 C T 19: 46,259,167 R181* probably null Het
Igkv6-17 T A 6: 70,371,502 F12I probably benign Het
Itln1 C A 1: 171,531,077 G174V probably damaging Het
Lrrc52 A G 1: 167,466,091 probably null Het
Matn2 A G 15: 34,402,925 Y432C probably damaging Het
Metap1d A G 2: 71,524,961 *336W probably null Het
Mgam2-ps T A 6: 40,802,555 noncoding transcript Het
Mrps9 T A 1: 42,862,515 V61D possibly damaging Het
Myh7b T C 2: 155,614,177 Y161H probably damaging Het
Myh9 T A 15: 77,768,853 D1428V probably damaging Het
N4bp3 A T 11: 51,644,479 probably null Het
Nat9 T A 11: 115,184,590 Q75L probably benign Het
Nop2 T C 6: 125,144,556 V767A probably benign Het
Ntrk2 A G 13: 59,126,493 K728E probably damaging Het
Olfr497 G A 7: 108,422,989 M139I probably benign Het
Olfr558 T G 7: 102,709,557 C99W probably damaging Het
Olfr836 T A 9: 19,121,010 H15Q probably null Het
Oraov1 T C 7: 144,928,978 probably null Het
Pcdhgb2 A G 18: 37,692,322 T789A probably benign Het
Pcyt2 T C 11: 120,611,174 D321G probably benign Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rbbp8 A T 18: 11,721,782 K355* probably null Het
Rhag T C 17: 40,836,467 Y407H probably damaging Het
Robo4 G A 9: 37,403,199 V161M probably damaging Het
Rpl27-ps3 C A 18: 6,332,922 N97K probably benign Het
Slc45a4 A G 15: 73,582,075 I691T possibly damaging Het
Slc9a9 A T 9: 94,936,449 probably benign Het
Spata5 T G 3: 37,458,325 F713C probably damaging Het
Stard13 A G 5: 151,060,815 F619L probably benign Het
Stt3b A T 9: 115,254,794 V438E probably damaging Het
Tacr3 C T 3: 134,829,421 T50I probably benign Het
Tacr3 G T 3: 134,929,929 C298F probably damaging Het
Taok3 C T 5: 117,228,066 T394M probably benign Het
Tctex1d1 T A 4: 103,004,229 I136K probably damaging Het
Tgfb1i1 A G 7: 128,249,176 D128G probably damaging Het
Tgfbr3l G T 8: 4,250,574 V251L probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Top3a A G 11: 60,742,412 S953P probably benign Het
Trappc10 T C 10: 78,197,863 K957E probably damaging Het
Ttn T A 2: 76,735,324 E28228V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vdr A T 15: 97,858,920 probably null Het
Zfp42 A T 8: 43,296,131 L111Q probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0526:Blm UTSW 7 80505893 nonsense probably null
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 splice site probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4049:Blm UTSW 7 80502862 missense probably benign 0.04
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4833:Blm UTSW 7 80466826 missense probably benign
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 splice site probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6114:Blm UTSW 7 80513487 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6254:Blm UTSW 7 80480342 missense probably benign 0.04
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
R8500:Blm UTSW 7 80455284 missense probably damaging 1.00
R8543:Blm UTSW 7 80494216 missense probably damaging 0.98
R8749:Blm UTSW 7 80512901 small insertion probably benign
R8774:Blm UTSW 7 80512901 small insertion probably benign
R8774:Blm UTSW 7 80512910 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512907 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512918 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512919 small insertion probably benign
R8775-TAIL:Blm UTSW 7 80512931 small insertion probably benign
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF002:Blm UTSW 7 80512927 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF028:Blm UTSW 7 80512905 nonsense probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTTCCCAAATTTTACTGCACTGAG -3'
(R):5'- TACCACCAGTAGTGCTCAGAG -3'

Sequencing Primer
(F):5'- GCCCTACAGGTGATGCTAATGTAC -3'
(R):5'- CAGTAGTGCTCAGAGCCACAG -3'
Posted On2015-10-21