Incidental Mutation 'R4695:Blm'
ID 355622
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene Name Bloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 042016-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4695 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80104741-80184896 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80143976 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 821 (D821V)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
AlphaFold O88700
Predicted Effect probably damaging
Transcript: ENSMUST00000081314
AA Change: D818V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: D818V

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170315
AA Change: D821V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: D821V

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205263
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,750,713 (GRCm39) M251K possibly damaging Het
Adcy2 A T 13: 68,875,962 (GRCm39) H513Q possibly damaging Het
Afg2a T G 3: 37,512,474 (GRCm39) F713C probably damaging Het
Ahctf1 A G 1: 179,580,619 (GRCm39) L1861P possibly damaging Het
Apc2 C A 10: 80,146,877 (GRCm39) R615S probably damaging Het
Arhgap45 A C 10: 79,861,364 (GRCm39) D509A probably damaging Het
Atp6v1c2 T C 12: 17,351,208 (GRCm39) T108A probably benign Het
C3 T A 17: 57,528,057 (GRCm39) I721L probably benign Het
Ccdc13 A T 9: 121,649,826 (GRCm39) V207E probably damaging Het
Ccndbp1 C T 2: 120,845,208 (GRCm39) probably benign Het
Cd180 A C 13: 102,842,268 (GRCm39) Q438P probably benign Het
Cd248 C T 19: 5,118,473 (GRCm39) T107M probably damaging Het
Cdan1 G A 2: 120,558,864 (GRCm39) R445C probably damaging Het
Cic C A 7: 24,973,013 (GRCm39) H915N possibly damaging Het
Cox8c T C 12: 102,865,742 (GRCm39) S40P possibly damaging Het
Cyp2d34 A T 15: 82,501,092 (GRCm39) C347S probably benign Het
Dhx30 A T 9: 109,914,356 (GRCm39) F974I probably damaging Het
Dlec1 A T 9: 118,972,221 (GRCm39) T1414S probably benign Het
Dlg2 C A 7: 92,087,170 (GRCm39) probably null Het
Dynlt5 T A 4: 102,861,426 (GRCm39) I136K probably damaging Het
Dzip1l T A 9: 99,529,258 (GRCm39) M329K probably benign Het
Dzip3 A T 16: 48,771,924 (GRCm39) L582I probably damaging Het
Emilin2 T C 17: 71,559,773 (GRCm39) Y1068C probably damaging Het
Fam221b T A 4: 43,659,622 (GRCm39) probably null Het
Fbxw22 A G 9: 109,207,939 (GRCm39) I444T probably damaging Het
Flnc T A 6: 29,440,428 (GRCm39) N245K probably damaging Het
Fnip1 T A 11: 54,390,245 (GRCm39) I380N probably damaging Het
Gbf1 C T 19: 46,247,606 (GRCm39) R181* probably null Het
Igkv6-17 T A 6: 70,348,486 (GRCm39) F12I probably benign Het
Itln1 C A 1: 171,358,645 (GRCm39) G174V probably damaging Het
Lrrc52 A G 1: 167,293,660 (GRCm39) probably null Het
LTO1 T C 7: 144,482,715 (GRCm39) probably null Het
Matn2 A G 15: 34,403,071 (GRCm39) Y432C probably damaging Het
Metap1d A G 2: 71,355,305 (GRCm39) *336W probably null Het
Mgam2-ps T A 6: 40,779,489 (GRCm39) noncoding transcript Het
Mrps9 T A 1: 42,901,675 (GRCm39) V61D possibly damaging Het
Myh7b T C 2: 155,456,097 (GRCm39) Y161H probably damaging Het
Myh9 T A 15: 77,653,053 (GRCm39) D1428V probably damaging Het
N4bp3 A T 11: 51,535,306 (GRCm39) probably null Het
Nat9 T A 11: 115,075,416 (GRCm39) Q75L probably benign Het
Nop2 T C 6: 125,121,519 (GRCm39) V767A probably benign Het
Ntrk2 A G 13: 59,274,307 (GRCm39) K728E probably damaging Het
Or51e1 T G 7: 102,358,764 (GRCm39) C99W probably damaging Het
Or5p72 G A 7: 108,022,196 (GRCm39) M139I probably benign Het
Or7g21 T A 9: 19,032,306 (GRCm39) H15Q probably null Het
Pcdhgb2 A G 18: 37,825,375 (GRCm39) T789A probably benign Het
Pcyt2 T C 11: 120,502,000 (GRCm39) D321G probably benign Het
Rad9a G A 19: 4,250,560 (GRCm39) R85C probably damaging Het
Rbbp8 A T 18: 11,854,839 (GRCm39) K355* probably null Het
Rhag T C 17: 41,147,358 (GRCm39) Y407H probably damaging Het
Robo4 G A 9: 37,314,495 (GRCm39) V161M probably damaging Het
Rpl27-ps3 C A 18: 6,332,922 (GRCm39) N97K probably benign Het
Slc45a4 A G 15: 73,453,924 (GRCm39) I691T possibly damaging Het
Slc9a9 A T 9: 94,818,502 (GRCm39) probably benign Het
Stard13 A G 5: 150,984,280 (GRCm39) F619L probably benign Het
Stt3b A T 9: 115,083,862 (GRCm39) V438E probably damaging Het
Tacr3 C T 3: 134,535,182 (GRCm39) T50I probably benign Het
Tacr3 G T 3: 134,635,690 (GRCm39) C298F probably damaging Het
Taok3 C T 5: 117,366,131 (GRCm39) T394M probably benign Het
Tgfb1i1 A G 7: 127,848,348 (GRCm39) D128G probably damaging Het
Tgfbr3l G T 8: 4,300,574 (GRCm39) V251L probably benign Het
Tom1l2 C G 11: 60,161,259 (GRCm39) R84P probably damaging Het
Top3a A G 11: 60,633,238 (GRCm39) S953P probably benign Het
Trappc10 T C 10: 78,033,697 (GRCm39) K957E probably damaging Het
Ttn T A 2: 76,565,668 (GRCm39) E28228V probably damaging Het
Ttn T A 2: 76,585,168 (GRCm39) I22042F probably damaging Het
Vdr A T 15: 97,756,801 (GRCm39) probably null Het
Zfp42 A T 8: 43,749,168 (GRCm39) L111Q probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80,123,819 (GRCm39) missense probably damaging 1.00
IGL01658:Blm APN 7 80,113,689 (GRCm39) missense probably damaging 0.98
IGL02048:Blm APN 7 80,152,709 (GRCm39) splice site probably benign
IGL02060:Blm APN 7 80,164,328 (GRCm39) splice site probably benign
IGL02063:Blm APN 7 80,159,167 (GRCm39) nonsense probably null
IGL02102:Blm APN 7 80,119,504 (GRCm39) missense probably damaging 1.00
IGL02420:Blm APN 7 80,145,754 (GRCm39) missense probably damaging 1.00
IGL02452:Blm APN 7 80,153,125 (GRCm39) splice site probably null
IGL02566:Blm APN 7 80,123,944 (GRCm39) missense probably damaging 1.00
IGL03387:Blm APN 7 80,143,895 (GRCm39) missense probably damaging 1.00
FR4304:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
FR4304:Blm UTSW 7 80,113,521 (GRCm39) frame shift probably null
FR4340:Blm UTSW 7 80,162,658 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
FR4449:Blm UTSW 7 80,162,656 (GRCm39) small insertion probably benign
FR4548:Blm UTSW 7 80,113,517 (GRCm39) frame shift probably null
FR4589:Blm UTSW 7 80,113,518 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,522 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,519 (GRCm39) frame shift probably null
FR4976:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4976:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
R0133:Blm UTSW 7 80,152,115 (GRCm39) missense possibly damaging 0.93
R0194:Blm UTSW 7 80,114,694 (GRCm39) unclassified probably benign
R0526:Blm UTSW 7 80,155,641 (GRCm39) nonsense probably null
R0673:Blm UTSW 7 80,149,499 (GRCm39) critical splice donor site probably null
R0972:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R0980:Blm UTSW 7 80,149,706 (GRCm39) splice site probably null
R1120:Blm UTSW 7 80,131,214 (GRCm39) missense probably damaging 1.00
R1301:Blm UTSW 7 80,105,165 (GRCm39) nonsense probably null
R1769:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R1866:Blm UTSW 7 80,143,862 (GRCm39) missense probably benign 0.08
R1874:Blm UTSW 7 80,147,166 (GRCm39) missense probably damaging 1.00
R1966:Blm UTSW 7 80,162,934 (GRCm39) missense possibly damaging 0.86
R1991:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2013:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2014:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2015:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2016:Blm UTSW 7 80,155,674 (GRCm39) missense probably benign 0.26
R2103:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2161:Blm UTSW 7 80,131,118 (GRCm39) splice site probably null
R2215:Blm UTSW 7 80,149,595 (GRCm39) missense possibly damaging 0.69
R3689:Blm UTSW 7 80,162,827 (GRCm39) missense possibly damaging 0.56
R4049:Blm UTSW 7 80,152,610 (GRCm39) missense probably benign 0.04
R4155:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R4774:Blm UTSW 7 80,113,596 (GRCm39) missense probably damaging 1.00
R4833:Blm UTSW 7 80,116,574 (GRCm39) missense probably benign
R4835:Blm UTSW 7 80,159,294 (GRCm39) missense probably benign 0.41
R4994:Blm UTSW 7 80,108,573 (GRCm39) missense probably benign 0.00
R5039:Blm UTSW 7 80,155,621 (GRCm39) missense possibly damaging 0.50
R5330:Blm UTSW 7 80,108,684 (GRCm39) missense possibly damaging 0.73
R5375:Blm UTSW 7 80,162,977 (GRCm39) missense probably benign 0.00
R5408:Blm UTSW 7 80,152,370 (GRCm39) missense probably benign 0.01
R5574:Blm UTSW 7 80,149,521 (GRCm39) missense probably damaging 1.00
R5606:Blm UTSW 7 80,110,580 (GRCm39) splice site probably null
R5702:Blm UTSW 7 80,108,675 (GRCm39) missense probably benign 0.13
R5809:Blm UTSW 7 80,114,592 (GRCm39) missense probably damaging 1.00
R6114:Blm UTSW 7 80,163,235 (GRCm39) missense probably damaging 1.00
R6157:Blm UTSW 7 80,162,733 (GRCm39) missense probably benign 0.18
R6163:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6254:Blm UTSW 7 80,130,090 (GRCm39) missense probably benign 0.04
R6266:Blm UTSW 7 80,149,688 (GRCm39) missense probably benign 0.03
R6364:Blm UTSW 7 80,144,274 (GRCm39) nonsense probably null
R6446:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6502:Blm UTSW 7 80,131,223 (GRCm39) missense probably damaging 0.98
R6700:Blm UTSW 7 80,113,598 (GRCm39) missense possibly damaging 0.91
R7002:Blm UTSW 7 80,119,501 (GRCm39) missense probably benign 0.00
R7105:Blm UTSW 7 80,149,516 (GRCm39) missense probably benign 0.44
R7320:Blm UTSW 7 80,105,102 (GRCm39) nonsense probably null
R7465:Blm UTSW 7 80,162,863 (GRCm39) missense probably benign 0.02
R7561:Blm UTSW 7 80,152,276 (GRCm39) missense probably damaging 0.99
R8500:Blm UTSW 7 80,105,032 (GRCm39) missense probably damaging 1.00
R8543:Blm UTSW 7 80,143,964 (GRCm39) missense probably damaging 0.98
R8774-TAIL:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,666 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
R8775-TAIL:Blm UTSW 7 80,162,679 (GRCm39) small insertion probably benign
R8860:Blm UTSW 7 80,144,276 (GRCm39) missense probably benign 0.30
R8928:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R9089:Blm UTSW 7 80,162,867 (GRCm39) missense probably damaging 1.00
R9363:Blm UTSW 7 80,108,663 (GRCm39) missense probably damaging 1.00
RF001:Blm UTSW 7 80,162,675 (GRCm39) small insertion probably benign
RF001:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF001:Blm UTSW 7 80,162,651 (GRCm39) small insertion probably benign
RF002:Blm UTSW 7 80,162,675 (GRCm39) small insertion probably benign
RF002:Blm UTSW 7 80,162,653 (GRCm39) small insertion probably benign
RF007:Blm UTSW 7 80,162,681 (GRCm39) nonsense probably null
RF016:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF018:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF027:Blm UTSW 7 80,162,662 (GRCm39) frame shift probably null
RF028:Blm UTSW 7 80,162,653 (GRCm39) nonsense probably null
RF031:Blm UTSW 7 80,162,671 (GRCm39) small insertion probably benign
RF031:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF032:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF036:Blm UTSW 7 80,162,662 (GRCm39) nonsense probably null
RF044:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF053:Blm UTSW 7 80,162,669 (GRCm39) small insertion probably benign
RF064:Blm UTSW 7 80,162,671 (GRCm39) nonsense probably null
X0061:Blm UTSW 7 80,108,598 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTTCCCAAATTTTACTGCACTGAG -3'
(R):5'- TACCACCAGTAGTGCTCAGAG -3'

Sequencing Primer
(F):5'- GCCCTACAGGTGATGCTAATGTAC -3'
(R):5'- CAGTAGTGCTCAGAGCCACAG -3'
Posted On 2015-10-21