Incidental Mutation 'R4695:Tgfb1i1'
ID355626
Institutional Source Beutler Lab
Gene Symbol Tgfb1i1
Ensembl Gene ENSMUSG00000030782
Gene Nametransforming growth factor beta 1 induced transcript 1
SynonymsARA55, TSC-5, hic-5
MMRRC Submission 042016-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R4695 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128246812-128255699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128249176 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 128 (D128G)
Ref Sequence ENSEMBL: ENSMUSP00000127695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044660] [ENSMUST00000070656] [ENSMUST00000163609] [ENSMUST00000164710] [ENSMUST00000165667] [ENSMUST00000167965] [ENSMUST00000169919] [ENSMUST00000170115]
Predicted Effect probably benign
Transcript: ENSMUST00000044660
SMART Domains Protein: ENSMUSP00000040568
Gene: ENSMUSG00000042178

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 62 104 N/A INTRINSIC
ARM 137 179 2.89e-1 SMART
ARM 180 221 3.32e-1 SMART
ARM 222 263 2.93e-2 SMART
Blast:ARM 265 306 1e-8 BLAST
low complexity region 313 338 N/A INTRINSIC
ARM 353 399 4.88e0 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 670 690 N/A INTRINSIC
Pfam:BTB 742 854 9.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070656
AA Change: D150G

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068529
Gene: ENSMUSG00000030782
AA Change: D150G

DomainStartEndE-ValueType
Pfam:Paxillin 19 183 1.7e-7 PFAM
LIM 210 261 5.18e-22 SMART
LIM 269 320 4.37e-20 SMART
LIM 328 379 3.69e-18 SMART
LIM 387 438 6.89e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163553
Predicted Effect probably benign
Transcript: ENSMUST00000163609
AA Change: D56G

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133134
Gene: ENSMUSG00000030782
AA Change: D56G

DomainStartEndE-ValueType
low complexity region 11 44 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
LIM 116 167 5.18e-22 SMART
LIM 175 226 4.37e-20 SMART
LIM 234 285 3.69e-18 SMART
LIM 293 344 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164710
AA Change: D189G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130964
Gene: ENSMUSG00000030782
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 28 48 N/A INTRINSIC
Pfam:Paxillin 49 178 1.4e-10 PFAM
low complexity region 197 209 N/A INTRINSIC
LIM 249 300 5.18e-22 SMART
LIM 308 359 4.37e-20 SMART
LIM 367 418 3.69e-18 SMART
LIM 426 477 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165667
AA Change: D128G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127695
Gene: ENSMUSG00000030782
AA Change: D128G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 27 37 N/A INTRINSIC
low complexity region 83 116 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
LIM 188 239 5.18e-22 SMART
LIM 247 298 4.37e-20 SMART
LIM 306 357 3.69e-18 SMART
LIM 365 416 6.89e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166755
Predicted Effect probably benign
Transcript: ENSMUST00000167965
AA Change: D167G

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132100
Gene: ENSMUSG00000030782
AA Change: D167G

DomainStartEndE-ValueType
Pfam:Paxillin 34 200 7.3e-8 PFAM
LIM 227 278 5.18e-22 SMART
LIM 286 337 4.37e-20 SMART
LIM 345 396 3.69e-18 SMART
LIM 404 455 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168825
SMART Domains Protein: ENSMUSP00000132685
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
LIM 165 216 5.18e-22 SMART
LIM 224 275 4.37e-20 SMART
LIM 283 334 3.69e-18 SMART
LIM 342 393 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169919
SMART Domains Protein: ENSMUSP00000131705
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 44 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170115
SMART Domains Protein: ENSMUSP00000129958
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
Pfam:Paxillin 17 112 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206691
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role to play in the treatment of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal response to wire injury of femoral arteries and increased VSMC apoptosis in response to wire injury or mechanical stress. Mice homozygous for a different knock-out allele show normal platelet integrin function both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,531,739 M251K possibly damaging Het
Adcy2 A T 13: 68,727,843 H513Q possibly damaging Het
Ahctf1 A G 1: 179,753,054 L1861P possibly damaging Het
Apc2 C A 10: 80,311,043 R615S probably damaging Het
Arhgap45 A C 10: 80,025,530 D509A probably damaging Het
Atp6v1c2 T C 12: 17,301,207 T108A probably benign Het
Blm T A 7: 80,494,228 D821V probably damaging Het
C3 T A 17: 57,221,057 I721L probably benign Het
Ccdc13 A T 9: 121,820,760 V207E probably damaging Het
Ccndbp1 C T 2: 121,014,727 probably benign Het
Cd180 A C 13: 102,705,760 Q438P probably benign Het
Cd248 C T 19: 5,068,445 T107M probably damaging Het
Cdan1 G A 2: 120,728,383 R445C probably damaging Het
Cic C A 7: 25,273,588 H915N possibly damaging Het
Cox8c T C 12: 102,899,483 S40P possibly damaging Het
Cyp2d34 A T 15: 82,616,891 C347S probably benign Het
Dhx30 A T 9: 110,085,288 F974I probably damaging Het
Dlec1 A T 9: 119,143,153 T1414S probably benign Het
Dlg2 C A 7: 92,437,962 probably null Het
Dzip1l T A 9: 99,647,205 M329K probably benign Het
Dzip3 A T 16: 48,951,561 L582I probably damaging Het
Emilin2 T C 17: 71,252,778 Y1068C probably damaging Het
Fam221b T A 4: 43,659,622 probably null Het
Fbxw22 A G 9: 109,378,871 I444T probably damaging Het
Flnc T A 6: 29,440,429 N245K probably damaging Het
Fnip1 T A 11: 54,499,419 I380N probably damaging Het
Gbf1 C T 19: 46,259,167 R181* probably null Het
Igkv6-17 T A 6: 70,371,502 F12I probably benign Het
Itln1 C A 1: 171,531,077 G174V probably damaging Het
Lrrc52 A G 1: 167,466,091 probably null Het
Matn2 A G 15: 34,402,925 Y432C probably damaging Het
Metap1d A G 2: 71,524,961 *336W probably null Het
Mgam2-ps T A 6: 40,802,555 noncoding transcript Het
Mrps9 T A 1: 42,862,515 V61D possibly damaging Het
Myh7b T C 2: 155,614,177 Y161H probably damaging Het
Myh9 T A 15: 77,768,853 D1428V probably damaging Het
N4bp3 A T 11: 51,644,479 probably null Het
Nat9 T A 11: 115,184,590 Q75L probably benign Het
Nop2 T C 6: 125,144,556 V767A probably benign Het
Ntrk2 A G 13: 59,126,493 K728E probably damaging Het
Olfr497 G A 7: 108,422,989 M139I probably benign Het
Olfr558 T G 7: 102,709,557 C99W probably damaging Het
Olfr836 T A 9: 19,121,010 H15Q probably null Het
Oraov1 T C 7: 144,928,978 probably null Het
Pcdhgb2 A G 18: 37,692,322 T789A probably benign Het
Pcyt2 T C 11: 120,611,174 D321G probably benign Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rbbp8 A T 18: 11,721,782 K355* probably null Het
Rhag T C 17: 40,836,467 Y407H probably damaging Het
Robo4 G A 9: 37,403,199 V161M probably damaging Het
Rpl27-ps3 C A 18: 6,332,922 N97K probably benign Het
Slc45a4 A G 15: 73,582,075 I691T possibly damaging Het
Slc9a9 A T 9: 94,936,449 probably benign Het
Spata5 T G 3: 37,458,325 F713C probably damaging Het
Stard13 A G 5: 151,060,815 F619L probably benign Het
Stt3b A T 9: 115,254,794 V438E probably damaging Het
Tacr3 C T 3: 134,829,421 T50I probably benign Het
Tacr3 G T 3: 134,929,929 C298F probably damaging Het
Taok3 C T 5: 117,228,066 T394M probably benign Het
Tctex1d1 T A 4: 103,004,229 I136K probably damaging Het
Tgfbr3l G T 8: 4,250,574 V251L probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Top3a A G 11: 60,742,412 S953P probably benign Het
Trappc10 T C 10: 78,197,863 K957E probably damaging Het
Ttn T A 2: 76,735,324 E28228V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vdr A T 15: 97,858,920 probably null Het
Zfp42 A T 8: 43,296,131 L111Q probably damaging Het
Other mutations in Tgfb1i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tgfb1i1 APN 7 128252521 missense probably damaging 1.00
IGL01919:Tgfb1i1 APN 7 128248482 splice site probably benign
IGL01996:Tgfb1i1 APN 7 128249292 splice site probably benign
IGL02527:Tgfb1i1 APN 7 128252562 splice site probably benign
IGL02596:Tgfb1i1 APN 7 128248896 start codon destroyed probably null 0.05
IGL03139:Tgfb1i1 APN 7 128249304 missense possibly damaging 0.79
PIT4431001:Tgfb1i1 UTSW 7 128249181 missense probably damaging 1.00
PIT4514001:Tgfb1i1 UTSW 7 128249181 missense probably damaging 1.00
R0114:Tgfb1i1 UTSW 7 128249494 missense probably damaging 1.00
R1833:Tgfb1i1 UTSW 7 128249498 splice site probably benign
R2116:Tgfb1i1 UTSW 7 128252805 missense probably damaging 1.00
R2508:Tgfb1i1 UTSW 7 128248913 unclassified probably null
R4756:Tgfb1i1 UTSW 7 128249399 missense probably damaging 1.00
R4853:Tgfb1i1 UTSW 7 128248668 nonsense probably null
R5024:Tgfb1i1 UTSW 7 128248217 start codon destroyed probably null 0.33
R5770:Tgfb1i1 UTSW 7 128248547 intron probably benign
R5839:Tgfb1i1 UTSW 7 128253365 makesense probably null
R6105:Tgfb1i1 UTSW 7 128248417 splice site probably null
R6178:Tgfb1i1 UTSW 7 128253345 missense probably damaging 0.98
R6310:Tgfb1i1 UTSW 7 128252837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGAGCTCACCCACTGTG -3'
(R):5'- TGGAGATGGGCATCCTTCAC -3'

Sequencing Primer
(F):5'- CTCACCCACTGTGTGAGTTTGG -3'
(R):5'- ATCCTTCACGGGTGGGG -3'
Posted On2015-10-21