Incidental Mutation 'R4695:Atp6v1c2'
ID355647
Institutional Source Beutler Lab
Gene Symbol Atp6v1c2
Ensembl Gene ENSMUSG00000020566
Gene NameATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms
MMRRC Submission 042016-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R4695 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location17284721-17329359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17301207 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 108 (T108A)
Ref Sequence ENSEMBL: ENSMUSP00000020884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020884] [ENSMUST00000095820] [ENSMUST00000140751] [ENSMUST00000153090] [ENSMUST00000156727] [ENSMUST00000221129] [ENSMUST00000222103]
Predicted Effect probably benign
Transcript: ENSMUST00000020884
AA Change: T108A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020884
Gene: ENSMUSG00000020566
AA Change: T108A

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 427 3.9e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095820
AA Change: T98A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000093500
Gene: ENSMUSG00000020566
AA Change: T98A

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 417 3.4e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140751
AA Change: T98A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123415
Gene: ENSMUSG00000020566
AA Change: T98A

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 133 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153090
AA Change: T98A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000119686
Gene: ENSMUSG00000020566
AA Change: T98A

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 134 3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156727
AA Change: T28A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117139
Gene: ENSMUSG00000020566
AA Change: T28A

DomainStartEndE-ValueType
Pfam:V-ATPase_C 1 347 2.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221129
AA Change: T98A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000222103
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A,three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain C subunit isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,531,739 M251K possibly damaging Het
Adcy2 A T 13: 68,727,843 H513Q possibly damaging Het
Ahctf1 A G 1: 179,753,054 L1861P possibly damaging Het
Apc2 C A 10: 80,311,043 R615S probably damaging Het
Arhgap45 A C 10: 80,025,530 D509A probably damaging Het
Blm T A 7: 80,494,228 D821V probably damaging Het
C3 T A 17: 57,221,057 I721L probably benign Het
Ccdc13 A T 9: 121,820,760 V207E probably damaging Het
Ccndbp1 C T 2: 121,014,727 probably benign Het
Cd180 A C 13: 102,705,760 Q438P probably benign Het
Cd248 C T 19: 5,068,445 T107M probably damaging Het
Cdan1 G A 2: 120,728,383 R445C probably damaging Het
Cic C A 7: 25,273,588 H915N possibly damaging Het
Cox8c T C 12: 102,899,483 S40P possibly damaging Het
Cyp2d34 A T 15: 82,616,891 C347S probably benign Het
Dhx30 A T 9: 110,085,288 F974I probably damaging Het
Dlec1 A T 9: 119,143,153 T1414S probably benign Het
Dlg2 C A 7: 92,437,962 probably null Het
Dzip1l T A 9: 99,647,205 M329K probably benign Het
Dzip3 A T 16: 48,951,561 L582I probably damaging Het
Emilin2 T C 17: 71,252,778 Y1068C probably damaging Het
Fam221b T A 4: 43,659,622 probably null Het
Fbxw22 A G 9: 109,378,871 I444T probably damaging Het
Flnc T A 6: 29,440,429 N245K probably damaging Het
Fnip1 T A 11: 54,499,419 I380N probably damaging Het
Gbf1 C T 19: 46,259,167 R181* probably null Het
Igkv6-17 T A 6: 70,371,502 F12I probably benign Het
Itln1 C A 1: 171,531,077 G174V probably damaging Het
Lrrc52 A G 1: 167,466,091 probably null Het
Matn2 A G 15: 34,402,925 Y432C probably damaging Het
Metap1d A G 2: 71,524,961 *336W probably null Het
Mgam2-ps T A 6: 40,802,555 noncoding transcript Het
Mrps9 T A 1: 42,862,515 V61D possibly damaging Het
Myh7b T C 2: 155,614,177 Y161H probably damaging Het
Myh9 T A 15: 77,768,853 D1428V probably damaging Het
N4bp3 A T 11: 51,644,479 probably null Het
Nat9 T A 11: 115,184,590 Q75L probably benign Het
Nop2 T C 6: 125,144,556 V767A probably benign Het
Ntrk2 A G 13: 59,126,493 K728E probably damaging Het
Olfr497 G A 7: 108,422,989 M139I probably benign Het
Olfr558 T G 7: 102,709,557 C99W probably damaging Het
Olfr836 T A 9: 19,121,010 H15Q probably null Het
Oraov1 T C 7: 144,928,978 probably null Het
Pcdhgb2 A G 18: 37,692,322 T789A probably benign Het
Pcyt2 T C 11: 120,611,174 D321G probably benign Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rbbp8 A T 18: 11,721,782 K355* probably null Het
Rhag T C 17: 40,836,467 Y407H probably damaging Het
Robo4 G A 9: 37,403,199 V161M probably damaging Het
Rpl27-ps3 C A 18: 6,332,922 N97K probably benign Het
Slc45a4 A G 15: 73,582,075 I691T possibly damaging Het
Slc9a9 A T 9: 94,936,449 probably benign Het
Spata5 T G 3: 37,458,325 F713C probably damaging Het
Stard13 A G 5: 151,060,815 F619L probably benign Het
Stt3b A T 9: 115,254,794 V438E probably damaging Het
Tacr3 C T 3: 134,829,421 T50I probably benign Het
Tacr3 G T 3: 134,929,929 C298F probably damaging Het
Taok3 C T 5: 117,228,066 T394M probably benign Het
Tctex1d1 T A 4: 103,004,229 I136K probably damaging Het
Tgfb1i1 A G 7: 128,249,176 D128G probably damaging Het
Tgfbr3l G T 8: 4,250,574 V251L probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Top3a A G 11: 60,742,412 S953P probably benign Het
Trappc10 T C 10: 78,197,863 K957E probably damaging Het
Ttn T A 2: 76,735,324 E28228V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vdr A T 15: 97,858,920 probably null Het
Zfp42 A T 8: 43,296,131 L111Q probably damaging Het
Other mutations in Atp6v1c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Atp6v1c2 APN 12 17308293 missense probably damaging 1.00
IGL01520:Atp6v1c2 APN 12 17297753 missense probably damaging 1.00
IGL02121:Atp6v1c2 APN 12 17291440 missense possibly damaging 0.65
IGL02990:Atp6v1c2 APN 12 17294740 missense probably damaging 1.00
IGL03243:Atp6v1c2 APN 12 17289121 missense probably benign 0.07
R0077:Atp6v1c2 UTSW 12 17321612 missense probably damaging 1.00
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0358:Atp6v1c2 UTSW 12 17284960 splice site probably benign
R0373:Atp6v1c2 UTSW 12 17288168 missense probably damaging 1.00
R0536:Atp6v1c2 UTSW 12 17307508 splice site probably null
R1164:Atp6v1c2 UTSW 12 17308316 missense probably damaging 1.00
R1400:Atp6v1c2 UTSW 12 17289130 missense probably benign 0.13
R2133:Atp6v1c2 UTSW 12 17321611 missense probably benign 0.03
R4825:Atp6v1c2 UTSW 12 17289060 missense probably benign 0.02
R5215:Atp6v1c2 UTSW 12 17291658 missense probably benign 0.08
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6196:Atp6v1c2 UTSW 12 17301186 nonsense probably null
R7059:Atp6v1c2 UTSW 12 17289004 nonsense probably null
R7505:Atp6v1c2 UTSW 12 17297723 splice site probably null
R7559:Atp6v1c2 UTSW 12 17301214 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TACATAGGGTCACTCAGGGG -3'
(R):5'- CCATTGGCTTTGAACTGCTC -3'

Sequencing Primer
(F):5'- TCACTCAGGGGCTAGCATC -3'
(R):5'- ATGGAGCATCTGCACTTCCAGAG -3'
Posted On2015-10-21