Mutagenetix > Incidental Mutations

Incidental Mutation 'R4695:Cd180'

355652

Institutional Source

Beutler Lab

Gene Symbol

Cd180

Ensembl Gene

ENSMUSG00000021624

Gene Name

CD180 antigen

Synonyms

Ly78, RP105

MMRRC Submission

042016-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102693558-102739629 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 102705760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Proline at position 438 (Q438P)

Ref Sequence

ENSEMBL: ENSMUSP00000022124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]

AlphaFold

Q62192

PDB Structure

Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000022124
AA Change: Q438P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: Q438P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LRR	76	99	1.07e0	SMART
LRR	193	221	1.76e2	SMART
LRR	297	320	1.66e1	SMART
Pfam:LRR_8	321	382	4.2e-13	PFAM
LRR	395	418	3e1	SMART
LRR	444	467	3.09e1	SMART
LRR	495	518	4.97e0	SMART
LRR	519	542	2.4e1	SMART
low complexity region	555	567	N/A	INTRINSIC
LRRCT	577	626	5.11e-8	SMART
transmembrane domain	628	650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167144

SMART Domains

Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000171267

SMART Domains

Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	2e-38	PDB
SCOP:d1m0za_	35	84	9e-4	SMART
Blast:LRR	51	75	7e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts10	T	A	17: 33,531,739	M251K	possibly damaging	Het
Adcy2	A	T	13: 68,727,843	H513Q	possibly damaging	Het
Ahctf1	A	G	1: 179,753,054	L1861P	possibly damaging	Het
Apc2	C	A	10: 80,311,043	R615S	probably damaging	Het
Arhgap45	A	C	10: 80,025,530	D509A	probably damaging	Het
Atp6v1c2	T	C	12: 17,301,207	T108A	probably benign	Het
Blm	T	A	7: 80,494,228	D821V	probably damaging	Het
C3	T	A	17: 57,221,057	I721L	probably benign	Het
Ccdc13	A	T	9: 121,820,760	V207E	probably damaging	Het
Ccndbp1	C	T	2: 121,014,727		probably benign	Het
Cd248	C	T	19: 5,068,445	T107M	probably damaging	Het
Cdan1	G	A	2: 120,728,383	R445C	probably damaging	Het
Cic	C	A	7: 25,273,588	H915N	possibly damaging	Het
Cox8c	T	C	12: 102,899,483	S40P	possibly damaging	Het
Cyp2d34	A	T	15: 82,616,891	C347S	probably benign	Het
Dhx30	A	T	9: 110,085,288	F974I	probably damaging	Het
Dlec1	A	T	9: 119,143,153	T1414S	probably benign	Het
Dlg2	C	A	7: 92,437,962		probably null	Het
Dzip1l	T	A	9: 99,647,205	M329K	probably benign	Het
Dzip3	A	T	16: 48,951,561	L582I	probably damaging	Het
Emilin2	T	C	17: 71,252,778	Y1068C	probably damaging	Het
Fam221b	T	A	4: 43,659,622		probably null	Het
Fbxw22	A	G	9: 109,378,871	I444T	probably damaging	Het
Flnc	T	A	6: 29,440,429	N245K	probably damaging	Het
Fnip1	T	A	11: 54,499,419	I380N	probably damaging	Het
Gbf1	C	T	19: 46,259,167	R181*	probably null	Het
Igkv6-17	T	A	6: 70,371,502	F12I	probably benign	Het
Itln1	C	A	1: 171,531,077	G174V	probably damaging	Het
Lrrc52	A	G	1: 167,466,091		probably null	Het
Matn2	A	G	15: 34,402,925	Y432C	probably damaging	Het
Metap1d	A	G	2: 71,524,961	*336W	probably null	Het
Mgam2-ps	T	A	6: 40,802,555		noncoding transcript	Het
Mrps9	T	A	1: 42,862,515	V61D	possibly damaging	Het
Myh7b	T	C	2: 155,614,177	Y161H	probably damaging	Het
Myh9	T	A	15: 77,768,853	D1428V	probably damaging	Het
N4bp3	A	T	11: 51,644,479		probably null	Het
Nat9	T	A	11: 115,184,590	Q75L	probably benign	Het
Nop2	T	C	6: 125,144,556	V767A	probably benign	Het
Ntrk2	A	G	13: 59,126,493	K728E	probably damaging	Het
Olfr497	G	A	7: 108,422,989	M139I	probably benign	Het
Olfr558	T	G	7: 102,709,557	C99W	probably damaging	Het
Olfr836	T	A	9: 19,121,010	H15Q	probably null	Het
Oraov1	T	C	7: 144,928,978		probably null	Het
Pcdhgb2	A	G	18: 37,692,322	T789A	probably benign	Het
Pcyt2	T	C	11: 120,611,174	D321G	probably benign	Het
Rad9a	G	A	19: 4,200,561	R85C	probably damaging	Het
Rbbp8	A	T	18: 11,721,782	K355*	probably null	Het
Rhag	T	C	17: 40,836,467	Y407H	probably damaging	Het
Robo4	G	A	9: 37,403,199	V161M	probably damaging	Het
Rpl27-ps3	C	A	18: 6,332,922	N97K	probably benign	Het
Slc45a4	A	G	15: 73,582,075	I691T	possibly damaging	Het
Slc9a9	A	T	9: 94,936,449		probably benign	Het
Spata5	T	G	3: 37,458,325	F713C	probably damaging	Het
Stard13	A	G	5: 151,060,815	F619L	probably benign	Het
Stt3b	A	T	9: 115,254,794	V438E	probably damaging	Het
Tacr3	G	T	3: 134,929,929	C298F	probably damaging	Het
Tacr3	C	T	3: 134,829,421	T50I	probably benign	Het
Taok3	C	T	5: 117,228,066	T394M	probably benign	Het
Tctex1d1	T	A	4: 103,004,229	I136K	probably damaging	Het
Tgfb1i1	A	G	7: 128,249,176	D128G	probably damaging	Het
Tgfbr3l	G	T	8: 4,250,574	V251L	probably benign	Het
Tom1l2	C	G	11: 60,270,433	R84P	probably damaging	Het
Top3a	A	G	11: 60,742,412	S953P	probably benign	Het
Trappc10	T	C	10: 78,197,863	K957E	probably damaging	Het
Ttn	T	A	2: 76,735,324	E28228V	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Vdr	A	T	15: 97,858,920		probably null	Het
Zfp42	A	T	8: 43,296,131	L111Q	probably damaging	Het

Other mutations in Cd180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cd180	APN	13	102705409	missense	probably benign
IGL00949:Cd180	APN	13	102693760	missense	possibly damaging	0.89
IGL01864:Cd180	APN	13	102706033	missense	possibly damaging	0.93
IGL01901:Cd180	APN	13	102706428	missense	probably benign	0.04
IGL01934:Cd180	APN	13	102702858	missense	probably damaging	1.00
IGL01998:Cd180	APN	13	102705214	missense	probably damaging	0.99
IGL02336:Cd180	APN	13	102705313	missense	probably damaging	0.98
IGL03031:Cd180	APN	13	102705027	missense	probably benign	0.00
IGL03139:Cd180	APN	13	102706416	missense	probably damaging	1.00
Volte_face	UTSW	13	102704923	missense	probably damaging	0.99
H8562:Cd180	UTSW	13	102705418	missense	probably benign	0.02
R0004:Cd180	UTSW	13	102702708	missense	probably benign	0.00
R0393:Cd180	UTSW	13	102705900	missense	probably damaging	0.99
R0565:Cd180	UTSW	13	102702874	intron	probably benign
R1080:Cd180	UTSW	13	102706220	nonsense	probably null
R1223:Cd180	UTSW	13	102706222	missense	possibly damaging	0.49
R1669:Cd180	UTSW	13	102705490	missense	probably damaging	1.00
R1772:Cd180	UTSW	13	102706242	missense	probably benign	0.11
R1784:Cd180	UTSW	13	102705859	missense	probably damaging	1.00
R1865:Cd180	UTSW	13	102706009	missense	probably benign
R2252:Cd180	UTSW	13	102706398	nonsense	probably null
R2385:Cd180	UTSW	13	102705183	missense	probably benign	0.00
R4653:Cd180	UTSW	13	102704908	missense	probably damaging	1.00
R4790:Cd180	UTSW	13	102702822	missense	probably damaging	0.98
R4934:Cd180	UTSW	13	102739164	critical splice acceptor site	probably null
R5052:Cd180	UTSW	13	102704895	missense	probably benign
R5154:Cd180	UTSW	13	102705774	missense	probably damaging	1.00
R5469:Cd180	UTSW	13	102704834	missense	probably benign	0.37
R5493:Cd180	UTSW	13	102706141	missense	probably benign	0.07
R5615:Cd180	UTSW	13	102706203	missense	probably benign	0.34
R5905:Cd180	UTSW	13	102706033	missense	possibly damaging	0.93
R6282:Cd180	UTSW	13	102693757	missense	possibly damaging	0.90
R6433:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R6456:Cd180	UTSW	13	102702836	missense	probably damaging	1.00
R6784:Cd180	UTSW	13	102702705	missense	probably damaging	0.97
R6815:Cd180	UTSW	13	102705429	missense	probably damaging	1.00
R6838:Cd180	UTSW	13	102702731	missense	probably benign	0.38
R6941:Cd180	UTSW	13	102706191	missense	probably benign	0.23
R7048:Cd180	UTSW	13	102704923	missense	probably damaging	0.99
R7338:Cd180	UTSW	13	102706428	missense	probably benign	0.04
R7466:Cd180	UTSW	13	102704995	missense	probably damaging	1.00
R7647:Cd180	UTSW	13	102705943	missense	probably damaging	1.00
R8179:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R8252:Cd180	UTSW	13	102705996	missense	probably benign	0.00
R8300:Cd180	UTSW	13	102704793	missense	probably benign	0.01
R8460:Cd180	UTSW	13	102702846	missense	probably damaging	1.00
R9122:Cd180	UTSW	13	102705009	missense	probably damaging	0.97
R9227:Cd180	UTSW	13	102705006	nonsense	probably null
R9229:Cd180	UTSW	13	102705006	nonsense	probably null
R9230:Cd180	UTSW	13	102705006	nonsense	probably null
R9399:Cd180	UTSW	13	102705513	missense	probably benign	0.00
Z1176:Cd180	UTSW	13	102705766	missense	probably damaging	1.00
Z1177:Cd180	UTSW	13	102706032	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CGGTACTGGCTGTTTAGAAAACC -3'
(R):5'- TCCCAGTGTCTGAAGTGAGTTG -3'

Sequencing Primer
(F):5'- TGACCTCAGCCATGATGACATTG -3'
(R):5'- AGTGAGTTGGTCTTTTGAATATTCCC -3'

Posted On

2015-10-21