Mutagenetix > Incidental Mutations

Incidental Mutation 'R4695:Vdr'

355657

Institutional Source

Beutler Lab

Gene Symbol

Vdr

Ensembl Gene

ENSMUSG00000022479

Gene Name

vitamin D (1,25-dihydroxyvitamin D3) receptor

Synonyms

Nr1i1

MMRRC Submission

042016-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97854425-97910630 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 97858920 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000023119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023119]

AlphaFold

P48281

Predicted Effect

probably null
Transcript: ENSMUST00000023119

SMART Domains

Protein: ENSMUSP00000023119
Gene: ENSMUSG00000022479

Domain	Start	End	E-Value	Type
ZnF_C4	21	92	1.4e-34	SMART
low complexity region	102	114	N/A	INTRINSIC
low complexity region	173	182	N/A	INTRINSIC
HOLI	227	389	3.54e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139656

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants fail to thrive after weaning and may exhibit excess mortality. Postweaning mutant mice develop alopecia, hypocalcemia, infertility, and rickets. Mutant females exhibit uterine hypoplasia with impaired follicular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts10	T	A	17: 33,531,739	M251K	possibly damaging	Het
Adcy2	A	T	13: 68,727,843	H513Q	possibly damaging	Het
Ahctf1	A	G	1: 179,753,054	L1861P	possibly damaging	Het
Apc2	C	A	10: 80,311,043	R615S	probably damaging	Het
Arhgap45	A	C	10: 80,025,530	D509A	probably damaging	Het
Atp6v1c2	T	C	12: 17,301,207	T108A	probably benign	Het
Blm	T	A	7: 80,494,228	D821V	probably damaging	Het
C3	T	A	17: 57,221,057	I721L	probably benign	Het
Ccdc13	A	T	9: 121,820,760	V207E	probably damaging	Het
Ccndbp1	C	T	2: 121,014,727		probably benign	Het
Cd180	A	C	13: 102,705,760	Q438P	probably benign	Het
Cd248	C	T	19: 5,068,445	T107M	probably damaging	Het
Cdan1	G	A	2: 120,728,383	R445C	probably damaging	Het
Cic	C	A	7: 25,273,588	H915N	possibly damaging	Het
Cox8c	T	C	12: 102,899,483	S40P	possibly damaging	Het
Cyp2d34	A	T	15: 82,616,891	C347S	probably benign	Het
Dhx30	A	T	9: 110,085,288	F974I	probably damaging	Het
Dlec1	A	T	9: 119,143,153	T1414S	probably benign	Het
Dlg2	C	A	7: 92,437,962		probably null	Het
Dzip1l	T	A	9: 99,647,205	M329K	probably benign	Het
Dzip3	A	T	16: 48,951,561	L582I	probably damaging	Het
Emilin2	T	C	17: 71,252,778	Y1068C	probably damaging	Het
Fam221b	T	A	4: 43,659,622		probably null	Het
Fbxw22	A	G	9: 109,378,871	I444T	probably damaging	Het
Flnc	T	A	6: 29,440,429	N245K	probably damaging	Het
Fnip1	T	A	11: 54,499,419	I380N	probably damaging	Het
Gbf1	C	T	19: 46,259,167	R181*	probably null	Het
Igkv6-17	T	A	6: 70,371,502	F12I	probably benign	Het
Itln1	C	A	1: 171,531,077	G174V	probably damaging	Het
Lrrc52	A	G	1: 167,466,091		probably null	Het
Matn2	A	G	15: 34,402,925	Y432C	probably damaging	Het
Metap1d	A	G	2: 71,524,961	*336W	probably null	Het
Mgam2-ps	T	A	6: 40,802,555		noncoding transcript	Het
Mrps9	T	A	1: 42,862,515	V61D	possibly damaging	Het
Myh7b	T	C	2: 155,614,177	Y161H	probably damaging	Het
Myh9	T	A	15: 77,768,853	D1428V	probably damaging	Het
N4bp3	A	T	11: 51,644,479		probably null	Het
Nat9	T	A	11: 115,184,590	Q75L	probably benign	Het
Nop2	T	C	6: 125,144,556	V767A	probably benign	Het
Ntrk2	A	G	13: 59,126,493	K728E	probably damaging	Het
Olfr497	G	A	7: 108,422,989	M139I	probably benign	Het
Olfr558	T	G	7: 102,709,557	C99W	probably damaging	Het
Olfr836	T	A	9: 19,121,010	H15Q	probably null	Het
Oraov1	T	C	7: 144,928,978		probably null	Het
Pcdhgb2	A	G	18: 37,692,322	T789A	probably benign	Het
Pcyt2	T	C	11: 120,611,174	D321G	probably benign	Het
Rad9a	G	A	19: 4,200,561	R85C	probably damaging	Het
Rbbp8	A	T	18: 11,721,782	K355*	probably null	Het
Rhag	T	C	17: 40,836,467	Y407H	probably damaging	Het
Robo4	G	A	9: 37,403,199	V161M	probably damaging	Het
Rpl27-ps3	C	A	18: 6,332,922	N97K	probably benign	Het
Slc45a4	A	G	15: 73,582,075	I691T	possibly damaging	Het
Slc9a9	A	T	9: 94,936,449		probably benign	Het
Spata5	T	G	3: 37,458,325	F713C	probably damaging	Het
Stard13	A	G	5: 151,060,815	F619L	probably benign	Het
Stt3b	A	T	9: 115,254,794	V438E	probably damaging	Het
Tacr3	C	T	3: 134,829,421	T50I	probably benign	Het
Tacr3	G	T	3: 134,929,929	C298F	probably damaging	Het
Taok3	C	T	5: 117,228,066	T394M	probably benign	Het
Tctex1d1	T	A	4: 103,004,229	I136K	probably damaging	Het
Tgfb1i1	A	G	7: 128,249,176	D128G	probably damaging	Het
Tgfbr3l	G	T	8: 4,250,574	V251L	probably benign	Het
Tom1l2	C	G	11: 60,270,433	R84P	probably damaging	Het
Top3a	A	G	11: 60,742,412	S953P	probably benign	Het
Trappc10	T	C	10: 78,197,863	K957E	probably damaging	Het
Ttn	T	A	2: 76,735,324	E28228V	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Zfp42	A	T	8: 43,296,131	L111Q	probably damaging	Het

Other mutations in Vdr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Vdr	APN	15	97884854	missense	probably damaging	1.00
IGL02813:Vdr	APN	15	97869681	missense	probably benign	0.45
R1705_Vdr_039	UTSW	15	97867171	missense	probably damaging	1.00
yangshuo	UTSW	15	97859121	missense	probably damaging	1.00
R0400:Vdr	UTSW	15	97869351	missense	probably benign	0.00
R1102:Vdr	UTSW	15	97859121	missense	probably damaging	1.00
R1172:Vdr	UTSW	15	97869333	missense	probably benign	0.05
R1173:Vdr	UTSW	15	97869333	missense	probably benign	0.05
R1268:Vdr	UTSW	15	97857475	missense	probably benign	0.39
R1705:Vdr	UTSW	15	97867171	missense	probably damaging	1.00
R2879:Vdr	UTSW	15	97859127	missense	probably benign	0.01
R3030:Vdr	UTSW	15	97857563	missense	probably benign	0.00
R5074:Vdr	UTSW	15	97857578	missense	probably benign	0.35
R5710:Vdr	UTSW	15	97859127	missense	probably damaging	1.00
R5710:Vdr	UTSW	15	97867208	missense	probably benign	0.02
R5845:Vdr	UTSW	15	97869766	missense	possibly damaging	0.46
R5982:Vdr	UTSW	15	97857596	missense	probably benign	0.37
R6776:Vdr	UTSW	15	97869828	missense	probably damaging	1.00
R6865:Vdr	UTSW	15	97857505	missense	probably damaging	1.00
R7870:Vdr	UTSW	15	97884890	missense	possibly damaging	0.59
R9036:Vdr	UTSW	15	97867208	missense	probably benign	0.03
R9110:Vdr	UTSW	15	97884872	missense	probably damaging	0.98
R9114:Vdr	UTSW	15	97867255	missense	probably benign
R9214:Vdr	UTSW	15	97869719	missense	probably benign	0.01
R9381:Vdr	UTSW	15	97857452	missense	probably damaging	1.00
X0023:Vdr	UTSW	15	97869818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCAGCAAAGTTAGCATTTCC -3'
(R):5'- TGCGGTAGGACTCCACCTATAC -3'

Sequencing Primer
(F):5'- GCTCTGAGCAGGTCTCTGTC -3'
(R):5'- GGTAGGACTCCACCTATACTCCCTC -3'

Posted On

2015-10-21