Mutagenetix > Incidental Mutation

Incidental Mutation 'R4695:Dzip3'

355658

Institutional Source

Beutler Lab

Gene Symbol

Dzip3

Ensembl Gene

ENSMUSG00000064061

Gene Name

DAZ interacting protein 3, zinc finger

Synonyms

2A-HUB, 6430549P11Rik, 2310047C04Rik

MMRRC Submission

042016-MU

Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48924232-48994165 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 48951561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 582 (L582I)

Ref Sequence

ENSEMBL: ENSMUSP00000113344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114516

SMART Domains

Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061

Domain	Start	End	E-Value	Type
low complexity region	451	472	N/A	INTRINSIC
coiled coil region	548	568	N/A	INTRINSIC
coiled coil region	599	650	N/A	INTRINSIC
low complexity region	743	754	N/A	INTRINSIC
low complexity region	883	891	N/A	INTRINSIC
RING	938	977	2.09e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121869
AA Change: L582I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: L582I

Domain	Start	End	E-Value	Type
low complexity region	657	678	N/A	INTRINSIC
coiled coil region	754	774	N/A	INTRINSIC
coiled coil region	805	856	N/A	INTRINSIC
low complexity region	949	960	N/A	INTRINSIC
low complexity region	1089	1097	N/A	INTRINSIC
RING	1144	1183	2.09e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133377

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts10	T	A	17: 33,531,739	M251K	possibly damaging	Het
Adcy2	A	T	13: 68,727,843	H513Q	possibly damaging	Het
Ahctf1	A	G	1: 179,753,054	L1861P	possibly damaging	Het
Apc2	C	A	10: 80,311,043	R615S	probably damaging	Het
Arhgap45	A	C	10: 80,025,530	D509A	probably damaging	Het
Atp6v1c2	T	C	12: 17,301,207	T108A	probably benign	Het
Blm	T	A	7: 80,494,228	D821V	probably damaging	Het
C3	T	A	17: 57,221,057	I721L	probably benign	Het
Ccdc13	A	T	9: 121,820,760	V207E	probably damaging	Het
Ccndbp1	C	T	2: 121,014,727		probably benign	Het
Cd180	A	C	13: 102,705,760	Q438P	probably benign	Het
Cd248	C	T	19: 5,068,445	T107M	probably damaging	Het
Cdan1	G	A	2: 120,728,383	R445C	probably damaging	Het
Cic	C	A	7: 25,273,588	H915N	possibly damaging	Het
Cox8c	T	C	12: 102,899,483	S40P	possibly damaging	Het
Cyp2d34	A	T	15: 82,616,891	C347S	probably benign	Het
Dhx30	A	T	9: 110,085,288	F974I	probably damaging	Het
Dlec1	A	T	9: 119,143,153	T1414S	probably benign	Het
Dlg2	C	A	7: 92,437,962		probably null	Het
Dzip1l	T	A	9: 99,647,205	M329K	probably benign	Het
Emilin2	T	C	17: 71,252,778	Y1068C	probably damaging	Het
Fam221b	T	A	4: 43,659,622		probably null	Het
Fbxw22	A	G	9: 109,378,871	I444T	probably damaging	Het
Flnc	T	A	6: 29,440,429	N245K	probably damaging	Het
Fnip1	T	A	11: 54,499,419	I380N	probably damaging	Het
Gbf1	C	T	19: 46,259,167	R181*	probably null	Het
Igkv6-17	T	A	6: 70,371,502	F12I	probably benign	Het
Itln1	C	A	1: 171,531,077	G174V	probably damaging	Het
Lrrc52	A	G	1: 167,466,091		probably null	Het
Matn2	A	G	15: 34,402,925	Y432C	probably damaging	Het
Metap1d	A	G	2: 71,524,961	*336W	probably null	Het
Mgam2-ps	T	A	6: 40,802,555		noncoding transcript	Het
Mrps9	T	A	1: 42,862,515	V61D	possibly damaging	Het
Myh7b	T	C	2: 155,614,177	Y161H	probably damaging	Het
Myh9	T	A	15: 77,768,853	D1428V	probably damaging	Het
N4bp3	A	T	11: 51,644,479		probably null	Het
Nat9	T	A	11: 115,184,590	Q75L	probably benign	Het
Nop2	T	C	6: 125,144,556	V767A	probably benign	Het
Ntrk2	A	G	13: 59,126,493	K728E	probably damaging	Het
Olfr497	G	A	7: 108,422,989	M139I	probably benign	Het
Olfr558	T	G	7: 102,709,557	C99W	probably damaging	Het
Olfr836	T	A	9: 19,121,010	H15Q	probably null	Het
Oraov1	T	C	7: 144,928,978		probably null	Het
Pcdhgb2	A	G	18: 37,692,322	T789A	probably benign	Het
Pcyt2	T	C	11: 120,611,174	D321G	probably benign	Het
Rad9a	G	A	19: 4,200,561	R85C	probably damaging	Het
Rbbp8	A	T	18: 11,721,782	K355*	probably null	Het
Rhag	T	C	17: 40,836,467	Y407H	probably damaging	Het
Robo4	G	A	9: 37,403,199	V161M	probably damaging	Het
Rpl27-ps3	C	A	18: 6,332,922	N97K	probably benign	Het
Slc45a4	A	G	15: 73,582,075	I691T	possibly damaging	Het
Slc9a9	A	T	9: 94,936,449		probably benign	Het
Spata5	T	G	3: 37,458,325	F713C	probably damaging	Het
Stard13	A	G	5: 151,060,815	F619L	probably benign	Het
Stt3b	A	T	9: 115,254,794	V438E	probably damaging	Het
Tacr3	C	T	3: 134,829,421	T50I	probably benign	Het
Tacr3	G	T	3: 134,929,929	C298F	probably damaging	Het
Taok3	C	T	5: 117,228,066	T394M	probably benign	Het
Tctex1d1	T	A	4: 103,004,229	I136K	probably damaging	Het
Tgfb1i1	A	G	7: 128,249,176	D128G	probably damaging	Het
Tgfbr3l	G	T	8: 4,250,574	V251L	probably benign	Het
Tom1l2	C	G	11: 60,270,433	R84P	probably damaging	Het
Top3a	A	G	11: 60,742,412	S953P	probably benign	Het
Trappc10	T	C	10: 78,197,863	K957E	probably damaging	Het
Ttn	T	A	2: 76,735,324	E28228V	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Vdr	A	T	15: 97,858,920		probably null	Het
Zfp42	A	T	8: 43,296,131	L111Q	probably damaging	Het

Other mutations in Dzip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Dzip3	APN	16	48928415	missense	probably damaging	1.00
IGL00931:Dzip3	APN	16	48935497	critical splice donor site	probably null
IGL01109:Dzip3	APN	16	48929674	missense	probably benign	0.27
IGL01121:Dzip3	APN	16	48944881	missense	probably benign	0.10
IGL01328:Dzip3	APN	16	48972258	missense	probably damaging	1.00
IGL01729:Dzip3	APN	16	48928363	missense	possibly damaging	0.78
IGL02044:Dzip3	APN	16	48948427	missense	possibly damaging	0.90
IGL02051:Dzip3	APN	16	48972254	missense	probably benign	0.01
IGL02115:Dzip3	APN	16	48948485	missense	probably benign	0.00
IGL02125:Dzip3	APN	16	48927596	missense	probably damaging	1.00
IGL02136:Dzip3	APN	16	48927582	missense	possibly damaging	0.94
IGL02244:Dzip3	APN	16	48980988	missense	probably benign	0.01
IGL02253:Dzip3	APN	16	48944924	missense	probably benign	0.34
IGL02412:Dzip3	APN	16	48958457	missense	probably benign	0.00
IGL02452:Dzip3	APN	16	48938537	splice site	probably benign
IGL02481:Dzip3	APN	16	48975551	splice site	probably benign
IGL02499:Dzip3	APN	16	48933850	missense	probably damaging	1.00
IGL02511:Dzip3	APN	16	48936980	missense	possibly damaging	0.75
IGL02519:Dzip3	APN	16	48928396	missense	probably damaging	1.00
IGL02610:Dzip3	APN	16	48951653	missense	probably damaging	1.00
IGL03129:Dzip3	APN	16	48942083	missense	possibly damaging	0.51
IGL03342:Dzip3	APN	16	48929623	missense	probably damaging	0.98
IGL03493:Dzip3	APN	16	48951696	missense	probably benign	0.32
corvette	UTSW	16	48927540	critical splice donor site	probably null
dazwick	UTSW	16	48958465	missense	possibly damaging	0.90
1mM(1):Dzip3	UTSW	16	48951557	missense	probably damaging	1.00
PIT4651001:Dzip3	UTSW	16	48944878	missense	probably benign
R0313:Dzip3	UTSW	16	48937061	missense	probably damaging	0.99
R0483:Dzip3	UTSW	16	48947713	missense	possibly damaging	0.94
R0504:Dzip3	UTSW	16	48959643	splice site	probably benign
R0744:Dzip3	UTSW	16	48959675	missense	probably damaging	1.00
R0800:Dzip3	UTSW	16	48953808	splice site	probably benign
R0927:Dzip3	UTSW	16	48975477	missense	probably damaging	0.99
R0931:Dzip3	UTSW	16	48951558	missense	probably damaging	1.00
R1170:Dzip3	UTSW	16	48961208	missense	probably damaging	1.00
R1203:Dzip3	UTSW	16	48951817	missense	probably damaging	1.00
R1205:Dzip3	UTSW	16	48951681	missense	probably damaging	1.00
R1442:Dzip3	UTSW	16	48945622	missense	probably benign	0.19
R1526:Dzip3	UTSW	16	48937006	missense	probably damaging	1.00
R1560:Dzip3	UTSW	16	48951540	splice site	probably null
R1585:Dzip3	UTSW	16	48977878	splice site	probably benign
R1682:Dzip3	UTSW	16	48958417	critical splice donor site	probably null
R1957:Dzip3	UTSW	16	48927593	missense	probably damaging	1.00
R2472:Dzip3	UTSW	16	48953787	missense	possibly damaging	0.85
R2571:Dzip3	UTSW	16	48972218	splice site	probably null
R3040:Dzip3	UTSW	16	48928324	missense	probably damaging	1.00
R3081:Dzip3	UTSW	16	48927558	missense	probably damaging	1.00
R3615:Dzip3	UTSW	16	48937063	missense	probably damaging	1.00
R3616:Dzip3	UTSW	16	48937063	missense	probably damaging	1.00
R3786:Dzip3	UTSW	16	48975543	missense	probably benign	0.08
R3851:Dzip3	UTSW	16	48950013	missense	possibly damaging	0.94
R4097:Dzip3	UTSW	16	48958489	nonsense	probably null
R4371:Dzip3	UTSW	16	48943455	critical splice donor site	probably null
R4612:Dzip3	UTSW	16	48952040	nonsense	probably null
R4671:Dzip3	UTSW	16	48979590	nonsense	probably null
R4696:Dzip3	UTSW	16	48925969	unclassified	probably benign
R4769:Dzip3	UTSW	16	48938474	missense	probably damaging	0.97
R5063:Dzip3	UTSW	16	48953754	nonsense	probably null
R5321:Dzip3	UTSW	16	48957675	missense	possibly damaging	0.95
R5764:Dzip3	UTSW	16	48927361	intron	probably benign
R6020:Dzip3	UTSW	16	48951842	missense	probably damaging	1.00
R6218:Dzip3	UTSW	16	48958465	missense	possibly damaging	0.90
R6300:Dzip3	UTSW	16	48951807	missense	probably damaging	1.00
R6365:Dzip3	UTSW	16	48931273	missense	probably damaging	0.96
R6778:Dzip3	UTSW	16	48982083	missense	probably benign	0.00
R6915:Dzip3	UTSW	16	48942125	missense	possibly damaging	0.72
R7047:Dzip3	UTSW	16	48982126	missense	probably benign	0.04
R7059:Dzip3	UTSW	16	48980942	missense	probably benign	0.34
R7095:Dzip3	UTSW	16	48927790	missense	probably benign
R7227:Dzip3	UTSW	16	48951569	missense	probably damaging	0.99
R7319:Dzip3	UTSW	16	48927540	critical splice donor site	probably null
R7436:Dzip3	UTSW	16	48951989	missense	probably damaging	1.00
R7469:Dzip3	UTSW	16	48944879	missense	probably benign
R7526:Dzip3	UTSW	16	48975474	missense	probably damaging	0.99
R7964:Dzip3	UTSW	16	48951905	missense	probably damaging	1.00
R8131:Dzip3	UTSW	16	48933793	critical splice donor site	probably null
R8188:Dzip3	UTSW	16	48952136	missense	probably damaging	1.00
R8209:Dzip3	UTSW	16	48977944	missense	probably damaging	1.00
R8750:Dzip3	UTSW	16	48980975	missense	probably damaging	0.99
R8758:Dzip3	UTSW	16	48977937	missense	probably damaging	1.00
R8784:Dzip3	UTSW	16	48931265	missense	probably damaging	0.99
R9086:Dzip3	UTSW	16	48961130	missense	possibly damaging	0.81
R9157:Dzip3	UTSW	16	48927761	missense	probably benign
R9170:Dzip3	UTSW	16	48952038	missense	possibly damaging	0.74
R9762:Dzip3	UTSW	16	48928344	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGCTTCCAAATTATACTTCAAGGG -3'
(R):5'- TCTCAGTGAGATTCTGATGAATGG -3'

Sequencing Primer
(F):5'- AGGCTCTAAAACCCTAAATAG -3'
(R):5'- CTGATGAATGGTCTCACCGAGTTAC -3'

Posted On

2015-10-21