Incidental Mutation 'R4695:Rhag'
ID355660
Institutional Source Beutler Lab
Gene Symbol Rhag
Ensembl Gene ENSMUSG00000023926
Gene NameRhesus blood group-associated A glycoprotein
SynonymsRh50, CD241, Rh50A
MMRRC Submission 042016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4695 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location40811126-40840754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40836467 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 407 (Y407H)
Ref Sequence ENSEMBL: ENSMUSP00000024721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024721]
Predicted Effect probably damaging
Transcript: ENSMUST00000024721
AA Change: Y407H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024721
Gene: ENSMUSG00000023926
AA Change: Y407H

DomainStartEndE-ValueType
Pfam:Ammonium_transp 43 412 1.5e-83 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is erythrocyte-specific and is thought to be part of a membrane channel that transports ammonium and carbon dioxide across the blood cell membrane. The encoded protein appears to interact with Rh blood group antigens and Rh30 polypeptides. Defects in this gene are a cause of regulator type Rh-null hemolytic anemia (RHN), or Rh-deficiency syndrome.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ammonium and methylammonium transport in red cell ghosts, reduced basal adhesion of red blood cells to endothelial cells, a slight increase in iron levels, and decreased transferrin levels in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,531,739 M251K possibly damaging Het
Adcy2 A T 13: 68,727,843 H513Q possibly damaging Het
Ahctf1 A G 1: 179,753,054 L1861P possibly damaging Het
Apc2 C A 10: 80,311,043 R615S probably damaging Het
Arhgap45 A C 10: 80,025,530 D509A probably damaging Het
Atp6v1c2 T C 12: 17,301,207 T108A probably benign Het
Blm T A 7: 80,494,228 D821V probably damaging Het
C3 T A 17: 57,221,057 I721L probably benign Het
Ccdc13 A T 9: 121,820,760 V207E probably damaging Het
Ccndbp1 C T 2: 121,014,727 probably benign Het
Cd180 A C 13: 102,705,760 Q438P probably benign Het
Cd248 C T 19: 5,068,445 T107M probably damaging Het
Cdan1 G A 2: 120,728,383 R445C probably damaging Het
Cic C A 7: 25,273,588 H915N possibly damaging Het
Cox8c T C 12: 102,899,483 S40P possibly damaging Het
Cyp2d34 A T 15: 82,616,891 C347S probably benign Het
Dhx30 A T 9: 110,085,288 F974I probably damaging Het
Dlec1 A T 9: 119,143,153 T1414S probably benign Het
Dlg2 C A 7: 92,437,962 probably null Het
Dzip1l T A 9: 99,647,205 M329K probably benign Het
Dzip3 A T 16: 48,951,561 L582I probably damaging Het
Emilin2 T C 17: 71,252,778 Y1068C probably damaging Het
Fam221b T A 4: 43,659,622 probably null Het
Fbxw22 A G 9: 109,378,871 I444T probably damaging Het
Flnc T A 6: 29,440,429 N245K probably damaging Het
Fnip1 T A 11: 54,499,419 I380N probably damaging Het
Gbf1 C T 19: 46,259,167 R181* probably null Het
Igkv6-17 T A 6: 70,371,502 F12I probably benign Het
Itln1 C A 1: 171,531,077 G174V probably damaging Het
Lrrc52 A G 1: 167,466,091 probably null Het
Matn2 A G 15: 34,402,925 Y432C probably damaging Het
Metap1d A G 2: 71,524,961 *336W probably null Het
Mgam2-ps T A 6: 40,802,555 noncoding transcript Het
Mrps9 T A 1: 42,862,515 V61D possibly damaging Het
Myh7b T C 2: 155,614,177 Y161H probably damaging Het
Myh9 T A 15: 77,768,853 D1428V probably damaging Het
N4bp3 A T 11: 51,644,479 probably null Het
Nat9 T A 11: 115,184,590 Q75L probably benign Het
Nop2 T C 6: 125,144,556 V767A probably benign Het
Ntrk2 A G 13: 59,126,493 K728E probably damaging Het
Olfr497 G A 7: 108,422,989 M139I probably benign Het
Olfr558 T G 7: 102,709,557 C99W probably damaging Het
Olfr836 T A 9: 19,121,010 H15Q probably null Het
Oraov1 T C 7: 144,928,978 probably null Het
Pcdhgb2 A G 18: 37,692,322 T789A probably benign Het
Pcyt2 T C 11: 120,611,174 D321G probably benign Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rbbp8 A T 18: 11,721,782 K355* probably null Het
Robo4 G A 9: 37,403,199 V161M probably damaging Het
Rpl27-ps3 C A 18: 6,332,922 N97K probably benign Het
Slc45a4 A G 15: 73,582,075 I691T possibly damaging Het
Slc9a9 A T 9: 94,936,449 probably benign Het
Spata5 T G 3: 37,458,325 F713C probably damaging Het
Stard13 A G 5: 151,060,815 F619L probably benign Het
Stt3b A T 9: 115,254,794 V438E probably damaging Het
Tacr3 G T 3: 134,929,929 C298F probably damaging Het
Tacr3 C T 3: 134,829,421 T50I probably benign Het
Taok3 C T 5: 117,228,066 T394M probably benign Het
Tctex1d1 T A 4: 103,004,229 I136K probably damaging Het
Tgfb1i1 A G 7: 128,249,176 D128G probably damaging Het
Tgfbr3l G T 8: 4,250,574 V251L probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Top3a A G 11: 60,742,412 S953P probably benign Het
Trappc10 T C 10: 78,197,863 K957E probably damaging Het
Ttn T A 2: 76,735,324 E28228V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vdr A T 15: 97,858,920 probably null Het
Zfp42 A T 8: 43,296,131 L111Q probably damaging Het
Other mutations in Rhag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Rhag APN 17 40811287 missense possibly damaging 0.73
IGL01463:Rhag APN 17 40828755 missense probably damaging 1.00
IGL01954:Rhag APN 17 40828450 missense possibly damaging 0.88
IGL03000:Rhag APN 17 40828522 missense probably benign 0.00
R0385:Rhag UTSW 17 40834727 missense probably damaging 0.97
R0570:Rhag UTSW 17 40828913 splice site probably benign
R0811:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R0812:Rhag UTSW 17 40831578 missense possibly damaging 0.74
R1655:Rhag UTSW 17 40831596 missense probably damaging 0.98
R2376:Rhag UTSW 17 40811363 critical splice donor site probably null
R2698:Rhag UTSW 17 40836476 missense probably damaging 0.99
R4207:Rhag UTSW 17 40831653 missense probably damaging 0.99
R4705:Rhag UTSW 17 40836438 missense probably benign 0.35
R4729:Rhag UTSW 17 40828401 missense probably damaging 1.00
R4790:Rhag UTSW 17 40831290 missense probably benign 0.23
R4895:Rhag UTSW 17 40811351 missense probably benign
R5224:Rhag UTSW 17 40828504 missense probably damaging 0.98
R5685:Rhag UTSW 17 40831331 missense possibly damaging 0.88
R7403:Rhag UTSW 17 40834658 missense probably damaging 1.00
R7407:Rhag UTSW 17 40831334 missense possibly damaging 0.56
R7553:Rhag UTSW 17 40828395 missense probably damaging 1.00
R7884:Rhag UTSW 17 40831645 missense probably benign 0.06
R8056:Rhag UTSW 17 40828788 missense probably damaging 1.00
X0064:Rhag UTSW 17 40833505 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCCAAAATGTGCTAAGCTTCTGC -3'
(R):5'- AAACCAGTTGCCATTGTTTCTACC -3'

Sequencing Primer
(F):5'- CTGCTAATTATGTCAGCAAAAAGAGG -3'
(R):5'- TGCTGTCCCTGCAGACAC -3'
Posted On2015-10-21