Incidental Mutation 'R4696:Wscd2'
ID355687
Institutional Source Beutler Lab
Gene Symbol Wscd2
Ensembl Gene ENSMUSG00000063430
Gene NameWSC domain containing 2
Synonyms4933413A10Rik, C530024P05Rik
MMRRC Submission 041946-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4696 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location113490333-113589725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113551179 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 82 (V82E)
Ref Sequence ENSEMBL: ENSMUSP00000092021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094452]
Predicted Effect probably benign
Transcript: ENSMUST00000094452
AA Change: V82E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092021
Gene: ENSMUSG00000063430
AA Change: V82E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 44 61 N/A INTRINSIC
WSC 133 225 6.11e-44 SMART
WSC 236 330 9.49e-41 SMART
Blast:WSC 389 409 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181650
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik G A 7: 4,151,615 P58L possibly damaging Het
Abcc3 T C 11: 94,350,991 S1405G probably benign Het
Acaca T C 11: 84,280,435 V1165A possibly damaging Het
Acin1 C A 14: 54,643,017 probably benign Het
Akr1b8 G A 6: 34,363,377 V159I probably benign Het
Alms1 T C 6: 85,620,522 Y777H probably damaging Het
Cblc C A 7: 19,796,482 G101C probably damaging Het
Cic A G 7: 25,288,483 N1532S probably benign Het
Cipc T A 12: 86,952,940 probably benign Het
Clca4b T C 3: 144,911,385 I835V probably benign Het
Cntrob C T 11: 69,320,888 G170D probably damaging Het
Col14a1 A G 15: 55,372,602 Q304R unknown Het
Csmd3 T C 15: 47,913,968 T1181A probably benign Het
Dchs1 A G 7: 105,764,627 F994L probably damaging Het
Ddx42 C A 11: 106,247,703 A776D probably benign Het
Ddx58 A G 4: 40,203,798 probably benign Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dmpk A T 7: 19,088,214 N366Y probably damaging Het
Dmrt1 A G 19: 25,603,310 Y362C possibly damaging Het
Dock10 C T 1: 80,515,613 G1880D possibly damaging Het
Dzip1l A G 9: 99,663,611 R638G possibly damaging Het
Dzip3 T A 16: 48,925,969 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Eno4 T C 19: 58,945,636 S90P probably damaging Het
Epn2 C G 11: 61,535,303 A283P probably damaging Het
Eya3 T A 4: 132,670,232 Y67* probably null Het
Fat2 T C 11: 55,285,015 N1624S probably benign Het
Fez1 T A 9: 36,870,470 probably null Het
Fgfr1 T C 8: 25,563,488 S260P probably damaging Het
Glb1 A G 9: 114,464,152 S532G probably benign Het
Gm15455 A T 1: 33,837,793 noncoding transcript Het
Grid2ip A G 5: 143,391,376 probably benign Het
Guca2b C A 4: 119,656,799 G129V probably damaging Het
Hes3 T C 4: 152,287,667 E65G probably damaging Het
Itgbl1 T C 14: 123,966,708 C404R probably damaging Het
Kansl1 C T 11: 104,356,767 V586I possibly damaging Het
Krt18 A G 15: 102,031,858 D390G probably benign Het
Laptm5 T C 4: 130,933,671 probably benign Het
Lgals3bp C T 11: 118,398,151 E116K probably benign Het
Lrrc39 C T 3: 116,570,120 S114F probably damaging Het
Mfap3 T C 11: 57,528,291 probably null Het
Nphp3 A G 9: 104,022,732 H481R probably benign Het
Ntm T C 9: 29,179,205 T73A possibly damaging Het
Olfr1026 T A 2: 85,918,871 probably null Het
Olfr967 T A 9: 39,750,728 M114K probably damaging Het
Pbk G A 14: 65,811,937 C21Y probably benign Het
Pglyrp1 A G 7: 18,884,946 E74G probably benign Het
R3hdm1 G T 1: 128,236,766 probably benign Het
Rap1gds1 T C 3: 138,927,614 T599A probably damaging Het
Rims1 A T 1: 22,288,612 M1273K probably damaging Het
Sbf1 G A 15: 89,303,112 R721* probably null Het
Slc17a1 T C 13: 23,880,717 I388T probably damaging Het
Sprn A C 7: 140,153,556 probably benign Het
Tango6 T C 8: 106,700,231 V459A possibly damaging Het
Tert C T 13: 73,627,820 T230I probably benign Het
Thada T C 17: 84,426,186 D1011G possibly damaging Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trip11 A T 12: 101,885,290 N838K possibly damaging Het
Ttn A G 2: 76,767,653 W19639R probably damaging Het
Ubr4 T A 4: 139,408,672 S924T probably benign Het
Upb1 A G 10: 75,415,027 E110G probably benign Het
Vegfa C T 17: 46,028,346 probably null Het
Vmn1r231 T C 17: 20,890,639 K5E possibly damaging Het
Vmn2r16 A T 5: 109,339,302 I130F probably benign Het
Zfp462 A G 4: 55,008,612 T193A probably benign Het
Zfp467 A G 6: 48,439,357 probably benign Het
Zfp619 T C 7: 39,536,988 L814P probably benign Het
Other mutations in Wscd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Wscd2 APN 5 113551175 missense possibly damaging 0.56
IGL01113:Wscd2 APN 5 113570739 missense probably damaging 1.00
IGL01476:Wscd2 APN 5 113572321 missense probably damaging 0.99
IGL01894:Wscd2 APN 5 113572296 missense probably damaging 0.96
IGL02560:Wscd2 APN 5 113560984 missense probably benign 0.01
IGL02755:Wscd2 APN 5 113574031 missense possibly damaging 0.66
R0381:Wscd2 UTSW 5 113551131 missense probably damaging 0.96
R1144:Wscd2 UTSW 5 113561090 splice site probably null
R1858:Wscd2 UTSW 5 113551170 missense possibly damaging 0.63
R3695:Wscd2 UTSW 5 113551017 missense possibly damaging 0.82
R4231:Wscd2 UTSW 5 113560984 missense probably benign 0.00
R4232:Wscd2 UTSW 5 113560984 missense probably benign 0.00
R4667:Wscd2 UTSW 5 113577272 missense probably damaging 1.00
R5727:Wscd2 UTSW 5 113577350 missense possibly damaging 0.89
R6401:Wscd2 UTSW 5 113588145 makesense probably null
R7413:Wscd2 UTSW 5 113577341 missense probably benign 0.02
R7642:Wscd2 UTSW 5 113577414 missense possibly damaging 0.67
R7837:Wscd2 UTSW 5 113572333 missense probably damaging 1.00
R7920:Wscd2 UTSW 5 113572333 missense probably damaging 1.00
R8046:Wscd2 UTSW 5 113551115 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGCTGGCAATCTACCTGAC -3'
(R):5'- AACGAGACCAGTTTTGTGGCTG -3'

Sequencing Primer
(F):5'- TGGCAATCTACCTGACCGCTG -3'
(R):5'- GCTGTTATTTCTACATTGGTGCC -3'
Posted On2015-10-21