Incidental Mutation 'R4696:Cblc'
ID355694
Institutional Source Beutler Lab
Gene Symbol Cblc
Ensembl Gene ENSMUSG00000040525
Gene NameCasitas B-lineage lymphoma c
Synonyms2310076I21Rik, Cbl3, 2310079L19Rik
MMRRC Submission 041946-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4696 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19778881-19796809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19796482 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 101 (G101C)
Ref Sequence ENSEMBL: ENSMUSP00000104088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]
Predicted Effect probably damaging
Transcript: ENSMUST00000043822
AA Change: G101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525
AA Change: G101C

DomainStartEndE-ValueType
Pfam:Cbl_N 13 144 2.6e-44 PFAM
Pfam:Cbl_N2 148 231 1.8e-35 PFAM
SH2 234 347 4.35e0 SMART
RING 350 388 1.92e-6 SMART
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108449
AA Change: G101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525
AA Change: G101C

DomainStartEndE-ValueType
Pfam:Cbl_N 11 145 7.1e-20 PFAM
Pfam:Cbl_N2 147 231 2.3e-48 PFAM
SH2 234 333 5.28e0 SMART
low complexity region 414 429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145755
Meta Mutation Damage Score 0.2676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik G A 7: 4,151,615 P58L possibly damaging Het
Abcc3 T C 11: 94,350,991 S1405G probably benign Het
Acaca T C 11: 84,280,435 V1165A possibly damaging Het
Acin1 C A 14: 54,643,017 probably benign Het
Akr1b8 G A 6: 34,363,377 V159I probably benign Het
Alms1 T C 6: 85,620,522 Y777H probably damaging Het
Cic A G 7: 25,288,483 N1532S probably benign Het
Cipc T A 12: 86,952,940 probably benign Het
Clca4b T C 3: 144,911,385 I835V probably benign Het
Cntrob C T 11: 69,320,888 G170D probably damaging Het
Col14a1 A G 15: 55,372,602 Q304R unknown Het
Csmd3 T C 15: 47,913,968 T1181A probably benign Het
Dchs1 A G 7: 105,764,627 F994L probably damaging Het
Ddx42 C A 11: 106,247,703 A776D probably benign Het
Ddx58 A G 4: 40,203,798 probably benign Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dmpk A T 7: 19,088,214 N366Y probably damaging Het
Dmrt1 A G 19: 25,603,310 Y362C possibly damaging Het
Dock10 C T 1: 80,515,613 G1880D possibly damaging Het
Dzip1l A G 9: 99,663,611 R638G possibly damaging Het
Dzip3 T A 16: 48,925,969 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Eno4 T C 19: 58,945,636 S90P probably damaging Het
Epn2 C G 11: 61,535,303 A283P probably damaging Het
Eya3 T A 4: 132,670,232 Y67* probably null Het
Fat2 T C 11: 55,285,015 N1624S probably benign Het
Fez1 T A 9: 36,870,470 probably null Het
Fgfr1 T C 8: 25,563,488 S260P probably damaging Het
Glb1 A G 9: 114,464,152 S532G probably benign Het
Gm15455 A T 1: 33,837,793 noncoding transcript Het
Grid2ip A G 5: 143,391,376 probably benign Het
Guca2b C A 4: 119,656,799 G129V probably damaging Het
Hes3 T C 4: 152,287,667 E65G probably damaging Het
Itgbl1 T C 14: 123,966,708 C404R probably damaging Het
Kansl1 C T 11: 104,356,767 V586I possibly damaging Het
Krt18 A G 15: 102,031,858 D390G probably benign Het
Laptm5 T C 4: 130,933,671 probably benign Het
Lgals3bp C T 11: 118,398,151 E116K probably benign Het
Lrrc39 C T 3: 116,570,120 S114F probably damaging Het
Mfap3 T C 11: 57,528,291 probably null Het
Nphp3 A G 9: 104,022,732 H481R probably benign Het
Ntm T C 9: 29,179,205 T73A possibly damaging Het
Olfr1026 T A 2: 85,918,871 probably null Het
Olfr967 T A 9: 39,750,728 M114K probably damaging Het
Pbk G A 14: 65,811,937 C21Y probably benign Het
Pglyrp1 A G 7: 18,884,946 E74G probably benign Het
R3hdm1 G T 1: 128,236,766 probably benign Het
Rap1gds1 T C 3: 138,927,614 T599A probably damaging Het
Rims1 A T 1: 22,288,612 M1273K probably damaging Het
Sbf1 G A 15: 89,303,112 R721* probably null Het
Slc17a1 T C 13: 23,880,717 I388T probably damaging Het
Sprn A C 7: 140,153,556 probably benign Het
Tango6 T C 8: 106,700,231 V459A possibly damaging Het
Tert C T 13: 73,627,820 T230I probably benign Het
Thada T C 17: 84,426,186 D1011G possibly damaging Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trip11 A T 12: 101,885,290 N838K possibly damaging Het
Ttn A G 2: 76,767,653 W19639R probably damaging Het
Ubr4 T A 4: 139,408,672 S924T probably benign Het
Upb1 A G 10: 75,415,027 E110G probably benign Het
Vegfa C T 17: 46,028,346 probably null Het
Vmn1r231 T C 17: 20,890,639 K5E possibly damaging Het
Vmn2r16 A T 5: 109,339,302 I130F probably benign Het
Wscd2 T A 5: 113,551,179 V82E probably benign Het
Zfp462 A G 4: 55,008,612 T193A probably benign Het
Zfp467 A G 6: 48,439,357 probably benign Het
Zfp619 T C 7: 39,536,988 L814P probably benign Het
Other mutations in Cblc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Cblc APN 7 19785275 missense probably benign 0.00
R0583:Cblc UTSW 7 19792561 missense probably benign 0.41
R0847:Cblc UTSW 7 19790534 nonsense probably null
R1594:Cblc UTSW 7 19792546 missense probably damaging 1.00
R1626:Cblc UTSW 7 19796502 missense probably damaging 1.00
R1719:Cblc UTSW 7 19790474 missense probably benign 0.00
R1894:Cblc UTSW 7 19792577 missense probably damaging 0.99
R2011:Cblc UTSW 7 19784822 missense probably benign 0.01
R2395:Cblc UTSW 7 19785380 missense probably damaging 1.00
R2852:Cblc UTSW 7 19780964 splice site probably null
R3832:Cblc UTSW 7 19792172 missense probably damaging 0.98
R5159:Cblc UTSW 7 19785308 missense probably benign 0.01
R5328:Cblc UTSW 7 19792580 missense possibly damaging 0.68
R5487:Cblc UTSW 7 19784808 missense probably benign 0.06
R5659:Cblc UTSW 7 19792932 missense probably damaging 1.00
R6209:Cblc UTSW 7 19785305 missense possibly damaging 0.47
R6519:Cblc UTSW 7 19792863 missense probably damaging 1.00
R6841:Cblc UTSW 7 19792896 missense probably damaging 1.00
R7371:Cblc UTSW 7 19792903 missense probably benign 0.00
R7417:Cblc UTSW 7 19788974 missense probably benign 0.41
R7494:Cblc UTSW 7 19792812 missense possibly damaging 0.76
X0028:Cblc UTSW 7 19785273 missense probably benign
Z1177:Cblc UTSW 7 19785278 missense not run
Predicted Primers PCR Primer
(F):5'- AGGAGAGTTGAAGCTTGTACTTCTG -3'
(R):5'- AATGCAGGGATCCCAGGATG -3'

Sequencing Primer
(F):5'- AAGCTTGTACTTCTGGGTCTGAAG -3'
(R):5'- AGGGATCCCAGGATGGTCAC -3'
Posted On2015-10-21