Mutagenetix > Incidental Mutations

Incidental Mutation 'R4696:Nphp3'

355706

Institutional Source

Beutler Lab

Gene Symbol

Nphp3

Ensembl Gene

ENSMUSG00000032558

Gene Name

nephronophthisis 3 (adolescent)

Synonyms

3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3

MMRRC Submission

041946-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4696 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104002544-104043818 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104022732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 481 (H481R)

Ref Sequence

ENSEMBL: ENSMUSP00000141596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]

AlphaFold

Q7TNH6

Predicted Effect

probably benign
Transcript: ENSMUST00000035167
AA Change: H601R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: H601R

Domain	Start	End	E-Value	Type
low complexity region	46	69	N/A	INTRINSIC
coiled coil region	107	203	N/A	INTRINSIC
low complexity region	512	537	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC
low complexity region	640	650	N/A	INTRINSIC
TPR	938	971	3.16e1	SMART
TPR	980	1013	7.74e-2	SMART
TPR	1022	1055	3.24e1	SMART
low complexity region	1066	1080	N/A	INTRINSIC
TPR	1088	1121	3.67e-3	SMART
TPR	1130	1163	1.3e-3	SMART
TPR	1172	1205	4.38e-1	SMART
TPR	1214	1247	8.69e-5	SMART
TPR	1256	1289	9.03e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558
AA Change: H481R

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193439
AA Change: H507R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: H507R

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193642

Predicted Effect

probably benign
Transcript: ENSMUST00000194774
AA Change: H481R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: H481R

Domain	Start	End	E-Value	Type
coiled coil region	49	83	N/A	INTRINSIC
Pfam:NACHT	400	559	2e-6	PFAM
TPR	818	851	3.16e1	SMART
TPR	860	893	7.74e-2	SMART
TPR	902	935	3.24e1	SMART
low complexity region	946	960	N/A	INTRINSIC
TPR	968	1001	3.67e-3	SMART
TPR	1010	1043	1.3e-3	SMART
TPR	1052	1085	4.38e-1	SMART
TPR	1094	1127	8.69e-5	SMART
TPR	1136	1169	9.03e-3	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700027J19Rik	G	A	7: 4,151,615	P58L	possibly damaging	Het
Abcc3	T	C	11: 94,350,991	S1405G	probably benign	Het
Acaca	T	C	11: 84,280,435	V1165A	possibly damaging	Het
Acin1	C	A	14: 54,643,017		probably benign	Het
Akr1b8	G	A	6: 34,363,377	V159I	probably benign	Het
Alms1	T	C	6: 85,620,522	Y777H	probably damaging	Het
Cblc	C	A	7: 19,796,482	G101C	probably damaging	Het
Cic	A	G	7: 25,288,483	N1532S	probably benign	Het
Cipc	T	A	12: 86,952,940		probably benign	Het
Clca4b	T	C	3: 144,911,385	I835V	probably benign	Het
Cntrob	C	T	11: 69,320,888	G170D	probably damaging	Het
Col14a1	A	G	15: 55,372,602	Q304R	unknown	Het
Csmd3	T	C	15: 47,913,968	T1181A	probably benign	Het
Dchs1	A	G	7: 105,764,627	F994L	probably damaging	Het
Ddx42	C	A	11: 106,247,703	A776D	probably benign	Het
Ddx58	A	G	4: 40,203,798		probably benign	Het
Disp2	G	T	2: 118,791,684	E966*	probably null	Het
Dmpk	A	T	7: 19,088,214	N366Y	probably damaging	Het
Dmrt1	A	G	19: 25,603,310	Y362C	possibly damaging	Het
Dock10	C	T	1: 80,515,613	G1880D	possibly damaging	Het
Dzip1l	A	G	9: 99,663,611	R638G	possibly damaging	Het
Dzip3	T	A	16: 48,925,969		probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Eno4	T	C	19: 58,945,636	S90P	probably damaging	Het
Epn2	C	G	11: 61,535,303	A283P	probably damaging	Het
Eya3	T	A	4: 132,670,232	Y67*	probably null	Het
Fat2	T	C	11: 55,285,015	N1624S	probably benign	Het
Fez1	T	A	9: 36,870,470		probably null	Het
Fgfr1	T	C	8: 25,563,488	S260P	probably damaging	Het
Glb1	A	G	9: 114,464,152	S532G	probably benign	Het
Gm15455	A	T	1: 33,837,793		noncoding transcript	Het
Grid2ip	A	G	5: 143,391,376		probably benign	Het
Guca2b	C	A	4: 119,656,799	G129V	probably damaging	Het
Hes3	T	C	4: 152,287,667	E65G	probably damaging	Het
Itgbl1	T	C	14: 123,966,708	C404R	probably damaging	Het
Kansl1	C	T	11: 104,356,767	V586I	possibly damaging	Het
Krt18	A	G	15: 102,031,858	D390G	probably benign	Het
Laptm5	T	C	4: 130,933,671		probably benign	Het
Lgals3bp	C	T	11: 118,398,151	E116K	probably benign	Het
Lrrc39	C	T	3: 116,570,120	S114F	probably damaging	Het
Mfap3	T	C	11: 57,528,291		probably null	Het
Ntm	T	C	9: 29,179,205	T73A	possibly damaging	Het
Olfr1026	T	A	2: 85,918,871		probably null	Het
Olfr967	T	A	9: 39,750,728	M114K	probably damaging	Het
Pbk	G	A	14: 65,811,937	C21Y	probably benign	Het
Pglyrp1	A	G	7: 18,884,946	E74G	probably benign	Het
R3hdm1	G	T	1: 128,236,766		probably benign	Het
Rap1gds1	T	C	3: 138,927,614	T599A	probably damaging	Het
Rims1	A	T	1: 22,288,612	M1273K	probably damaging	Het
Sbf1	G	A	15: 89,303,112	R721*	probably null	Het
Slc17a1	T	C	13: 23,880,717	I388T	probably damaging	Het
Sprn	A	C	7: 140,153,556		probably benign	Het
Tango6	T	C	8: 106,700,231	V459A	possibly damaging	Het
Tert	C	T	13: 73,627,820	T230I	probably benign	Het
Thada	T	C	17: 84,426,186	D1011G	possibly damaging	Het
Tln2	C	T	9: 67,395,461	R76Q	probably damaging	Het
Trip11	A	T	12: 101,885,290	N838K	possibly damaging	Het
Ttn	A	G	2: 76,767,653	W19639R	probably damaging	Het
Ubr4	T	A	4: 139,408,672	S924T	probably benign	Het
Upb1	A	G	10: 75,415,027	E110G	probably benign	Het
Vegfa	C	T	17: 46,028,346		probably null	Het
Vmn1r231	T	C	17: 20,890,639	K5E	possibly damaging	Het
Vmn2r16	A	T	5: 109,339,302	I130F	probably benign	Het
Wscd2	T	A	5: 113,551,179	V82E	probably benign	Het
Zfp462	A	G	4: 55,008,612	T193A	probably benign	Het
Zfp467	A	G	6: 48,439,357		probably benign	Het
Zfp619	T	C	7: 39,536,988	L814P	probably benign	Het

Other mutations in Nphp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01707:Nphp3	APN	9	104018158	missense	possibly damaging	0.75
IGL02329:Nphp3	APN	9	104025968	missense	probably benign	0.19
lithograph	UTSW	9	104041990	missense	probably damaging	1.00
F5770:Nphp3	UTSW	9	104035894	critical splice donor site	probably null
FR4548:Nphp3	UTSW	9	104025939	small deletion	probably benign
FR4589:Nphp3	UTSW	9	104025939	small deletion	probably benign
R0112:Nphp3	UTSW	9	104037348	missense	possibly damaging	0.80
R0555:Nphp3	UTSW	9	104023434	missense	probably damaging	1.00
R0632:Nphp3	UTSW	9	104018274	missense	probably damaging	1.00
R0674:Nphp3	UTSW	9	104036282	critical splice donor site	probably null
R0743:Nphp3	UTSW	9	104022768	small deletion	probably benign
R0853:Nphp3	UTSW	9	104031933	missense	probably benign	0.03
R0920:Nphp3	UTSW	9	104031907	missense	probably benign	0.00
R1420:Nphp3	UTSW	9	104035893	critical splice donor site	probably null
R1464:Nphp3	UTSW	9	104031879	splice site	probably benign
R1476:Nphp3	UTSW	9	104025927	missense	possibly damaging	0.81
R1585:Nphp3	UTSW	9	104009214	missense	probably damaging	1.00
R1608:Nphp3	UTSW	9	104035840	missense	probably benign	0.30
R1688:Nphp3	UTSW	9	104003124	missense	probably damaging	1.00
R1691:Nphp3	UTSW	9	104002811	missense	probably benign
R1807:Nphp3	UTSW	9	104020741	missense	probably benign	0.01
R1857:Nphp3	UTSW	9	104021294	missense	possibly damaging	0.87
R1962:Nphp3	UTSW	9	104021338	missense	probably benign	0.00
R2127:Nphp3	UTSW	9	104008243	missense	probably damaging	0.98
R2138:Nphp3	UTSW	9	104025903	missense	possibly damaging	0.89
R2233:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R2234:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R3861:Nphp3	UTSW	9	104039326	unclassified	probably benign
R3928:Nphp3	UTSW	9	104011730	missense	probably damaging	0.99
R3961:Nphp3	UTSW	9	104003042	nonsense	probably null
R4182:Nphp3	UTSW	9	104038464	missense	probably benign	0.06
R4294:Nphp3	UTSW	9	104022717	missense	probably damaging	1.00
R4387:Nphp3	UTSW	9	104030020	missense	possibly damaging	0.94
R4625:Nphp3	UTSW	9	104036159	missense	possibly damaging	0.66
R4628:Nphp3	UTSW	9	104003058	missense	probably damaging	0.99
R4865:Nphp3	UTSW	9	104031970	missense	probably benign
R4886:Nphp3	UTSW	9	104002994	missense	probably damaging	1.00
R4973:Nphp3	UTSW	9	104031999	missense	probably benign
R5445:Nphp3	UTSW	9	104004723	missense	probably damaging	1.00
R5451:Nphp3	UTSW	9	104042022	missense	probably benign
R5520:Nphp3	UTSW	9	104024673	missense	probably benign	0.30
R5641:Nphp3	UTSW	9	104036153	missense	probably damaging	1.00
R5847:Nphp3	UTSW	9	104003037	missense	probably damaging	1.00
R5928:Nphp3	UTSW	9	104035797	missense	probably benign	0.01
R5931:Nphp3	UTSW	9	104020746	missense	probably damaging	1.00
R6161:Nphp3	UTSW	9	104031906	missense	probably benign	0.11
R6298:Nphp3	UTSW	9	104015441	missense	probably damaging	1.00
R6890:Nphp3	UTSW	9	104041954	missense	probably damaging	0.96
R7009:Nphp3	UTSW	9	104016116	missense	probably null	0.00
R7065:Nphp3	UTSW	9	104041990	missense	probably damaging	1.00
R7146:Nphp3	UTSW	9	104004837	nonsense	probably null
R7198:Nphp3	UTSW	9	104004775	missense	probably damaging	1.00
R7360:Nphp3	UTSW	9	104016078	critical splice acceptor site	probably null
R7369:Nphp3	UTSW	9	104018250	missense	probably damaging	0.99
R7554:Nphp3	UTSW	9	104042071	missense	probably damaging	0.98
R7591:Nphp3	UTSW	9	104018278	critical splice donor site	probably null
R7665:Nphp3	UTSW	9	104005393	splice site	probably null
R7672:Nphp3	UTSW	9	104031960	missense	probably benign
R7675:Nphp3	UTSW	9	104016088	missense	probably benign
R8039:Nphp3	UTSW	9	104031963	missense	probably benign
R8145:Nphp3	UTSW	9	104035851	missense	probably benign	0.16
R8211:Nphp3	UTSW	9	104031897	missense	possibly damaging	0.80
R8882:Nphp3	UTSW	9	104005594	missense	possibly damaging	0.77
R9020:Nphp3	UTSW	9	104031951	missense	probably benign	0.00
R9132:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9135:Nphp3	UTSW	9	104032015	missense	probably damaging	0.99
R9159:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9204:Nphp3	UTSW	9	104042106	missense	probably benign
R9226:Nphp3	UTSW	9	104008129	missense	probably benign	0.00
R9229:Nphp3	UTSW	9	104036177	missense	probably damaging	1.00
V7583:Nphp3	UTSW	9	104035894	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATACATGTCTGTGTGCACATGC -3'
(R):5'- CCAGAACTGAGATGGCACTG -3'

Sequencing Primer
(F):5'- ACACACCGGTACTTCACTGTGG -3'
(R):5'- GCACTGCCACCATTGCG -3'

Posted On

2015-10-21