Incidental Mutation 'R4696:Trip11'
ID355723
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Namethyroid hormone receptor interactor 11
SynonymsGMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission 041946-MU
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4696 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location101834043-101913267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101885290 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 838 (N838K)
Ref Sequence ENSEMBL: ENSMUSP00000021605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021605
AA Change: N838K

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: N838K

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176728
SMART Domains Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Orthopox_A5L 48 282 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177183
AA Change: N553K

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: N553K

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177480
Predicted Effect probably benign
Transcript: ENSMUST00000177536
SMART Domains Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 53 129 N/A INTRINSIC
coiled coil region 166 193 N/A INTRINSIC
coiled coil region 217 517 N/A INTRINSIC
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik G A 7: 4,151,615 P58L possibly damaging Het
Abcc3 T C 11: 94,350,991 S1405G probably benign Het
Acaca T C 11: 84,280,435 V1165A possibly damaging Het
Acin1 C A 14: 54,643,017 probably benign Het
Akr1b8 G A 6: 34,363,377 V159I probably benign Het
Alms1 T C 6: 85,620,522 Y777H probably damaging Het
Cblc C A 7: 19,796,482 G101C probably damaging Het
Cic A G 7: 25,288,483 N1532S probably benign Het
Cipc T A 12: 86,952,940 probably benign Het
Clca4b T C 3: 144,911,385 I835V probably benign Het
Cntrob C T 11: 69,320,888 G170D probably damaging Het
Col14a1 A G 15: 55,372,602 Q304R unknown Het
Csmd3 T C 15: 47,913,968 T1181A probably benign Het
Dchs1 A G 7: 105,764,627 F994L probably damaging Het
Ddx42 C A 11: 106,247,703 A776D probably benign Het
Ddx58 A G 4: 40,203,798 probably benign Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dmpk A T 7: 19,088,214 N366Y probably damaging Het
Dmrt1 A G 19: 25,603,310 Y362C possibly damaging Het
Dock10 C T 1: 80,515,613 G1880D possibly damaging Het
Dzip1l A G 9: 99,663,611 R638G possibly damaging Het
Dzip3 T A 16: 48,925,969 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Eno4 T C 19: 58,945,636 S90P probably damaging Het
Epn2 C G 11: 61,535,303 A283P probably damaging Het
Eya3 T A 4: 132,670,232 Y67* probably null Het
Fat2 T C 11: 55,285,015 N1624S probably benign Het
Fez1 T A 9: 36,870,470 probably null Het
Fgfr1 T C 8: 25,563,488 S260P probably damaging Het
Glb1 A G 9: 114,464,152 S532G probably benign Het
Gm15455 A T 1: 33,837,793 noncoding transcript Het
Grid2ip A G 5: 143,391,376 probably benign Het
Guca2b C A 4: 119,656,799 G129V probably damaging Het
Hes3 T C 4: 152,287,667 E65G probably damaging Het
Itgbl1 T C 14: 123,966,708 C404R probably damaging Het
Kansl1 C T 11: 104,356,767 V586I possibly damaging Het
Krt18 A G 15: 102,031,858 D390G probably benign Het
Laptm5 T C 4: 130,933,671 probably benign Het
Lgals3bp C T 11: 118,398,151 E116K probably benign Het
Lrrc39 C T 3: 116,570,120 S114F probably damaging Het
Mfap3 T C 11: 57,528,291 probably null Het
Nphp3 A G 9: 104,022,732 H481R probably benign Het
Ntm T C 9: 29,179,205 T73A possibly damaging Het
Olfr1026 T A 2: 85,918,871 probably null Het
Olfr967 T A 9: 39,750,728 M114K probably damaging Het
Pbk G A 14: 65,811,937 C21Y probably benign Het
Pglyrp1 A G 7: 18,884,946 E74G probably benign Het
R3hdm1 G T 1: 128,236,766 probably benign Het
Rap1gds1 T C 3: 138,927,614 T599A probably damaging Het
Rims1 A T 1: 22,288,612 M1273K probably damaging Het
Sbf1 G A 15: 89,303,112 R721* probably null Het
Slc17a1 T C 13: 23,880,717 I388T probably damaging Het
Sprn A C 7: 140,153,556 probably benign Het
Tango6 T C 8: 106,700,231 V459A possibly damaging Het
Tert C T 13: 73,627,820 T230I probably benign Het
Thada T C 17: 84,426,186 D1011G possibly damaging Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Ttn A G 2: 76,767,653 W19639R probably damaging Het
Ubr4 T A 4: 139,408,672 S924T probably benign Het
Upb1 A G 10: 75,415,027 E110G probably benign Het
Vegfa C T 17: 46,028,346 probably null Het
Vmn1r231 T C 17: 20,890,639 K5E possibly damaging Het
Vmn2r16 A T 5: 109,339,302 I130F probably benign Het
Wscd2 T A 5: 113,551,179 V82E probably benign Het
Zfp462 A G 4: 55,008,612 T193A probably benign Het
Zfp467 A G 6: 48,439,357 probably benign Het
Zfp619 T C 7: 39,536,988 L814P probably benign Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 unclassified probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4176:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R4903:Trip11 UTSW 12 101886806 critical splice donor site probably null
R5001:Trip11 UTSW 12 101884910 nonsense probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6590:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101846620 missense probably benign 0.00
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7023:Trip11 UTSW 12 101885867 missense probably benign 0.13
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101885380 missense probably benign 0.00
R7491:Trip11 UTSW 12 101885435 missense probably damaging 1.00
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATTCTGTGCAGCTGAGACAG -3'
(R):5'- GGAGCGCTTAATTCAACTCAATC -3'

Sequencing Primer
(F):5'- TGAGACAGCTCAGACTCCAG -3'
(R):5'- AGTATTGAGCAAATGGATACTGATC -3'
Posted On2015-10-21