Incidental Mutation 'R4696:Dzip3'
ID355735
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission 041946-MU
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4696 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 48925969 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably benign
Transcript: ENSMUST00000114516
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121869
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147358
Predicted Effect probably benign
Transcript: ENSMUST00000151950
SMART Domains Protein: ENSMUSP00000117675
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 82 90 N/A INTRINSIC
SCOP:d1ldjb_ 113 161 1e-3 SMART
Blast:RING 137 161 4e-10 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik G A 7: 4,151,615 P58L possibly damaging Het
Abcc3 T C 11: 94,350,991 S1405G probably benign Het
Acaca T C 11: 84,280,435 V1165A possibly damaging Het
Acin1 C A 14: 54,643,017 probably benign Het
Akr1b8 G A 6: 34,363,377 V159I probably benign Het
Alms1 T C 6: 85,620,522 Y777H probably damaging Het
Cblc C A 7: 19,796,482 G101C probably damaging Het
Cic A G 7: 25,288,483 N1532S probably benign Het
Cipc T A 12: 86,952,940 probably benign Het
Clca4b T C 3: 144,911,385 I835V probably benign Het
Cntrob C T 11: 69,320,888 G170D probably damaging Het
Col14a1 A G 15: 55,372,602 Q304R unknown Het
Csmd3 T C 15: 47,913,968 T1181A probably benign Het
Dchs1 A G 7: 105,764,627 F994L probably damaging Het
Ddx42 C A 11: 106,247,703 A776D probably benign Het
Ddx58 A G 4: 40,203,798 probably benign Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dmpk A T 7: 19,088,214 N366Y probably damaging Het
Dmrt1 A G 19: 25,603,310 Y362C possibly damaging Het
Dock10 C T 1: 80,515,613 G1880D possibly damaging Het
Dzip1l A G 9: 99,663,611 R638G possibly damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Eno4 T C 19: 58,945,636 S90P probably damaging Het
Epn2 C G 11: 61,535,303 A283P probably damaging Het
Eya3 T A 4: 132,670,232 Y67* probably null Het
Fat2 T C 11: 55,285,015 N1624S probably benign Het
Fez1 T A 9: 36,870,470 probably null Het
Fgfr1 T C 8: 25,563,488 S260P probably damaging Het
Glb1 A G 9: 114,464,152 S532G probably benign Het
Gm15455 A T 1: 33,837,793 noncoding transcript Het
Grid2ip A G 5: 143,391,376 probably benign Het
Guca2b C A 4: 119,656,799 G129V probably damaging Het
Hes3 T C 4: 152,287,667 E65G probably damaging Het
Itgbl1 T C 14: 123,966,708 C404R probably damaging Het
Kansl1 C T 11: 104,356,767 V586I possibly damaging Het
Krt18 A G 15: 102,031,858 D390G probably benign Het
Laptm5 T C 4: 130,933,671 probably benign Het
Lgals3bp C T 11: 118,398,151 E116K probably benign Het
Lrrc39 C T 3: 116,570,120 S114F probably damaging Het
Mfap3 T C 11: 57,528,291 probably null Het
Nphp3 A G 9: 104,022,732 H481R probably benign Het
Ntm T C 9: 29,179,205 T73A possibly damaging Het
Olfr1026 T A 2: 85,918,871 probably null Het
Olfr967 T A 9: 39,750,728 M114K probably damaging Het
Pbk G A 14: 65,811,937 C21Y probably benign Het
Pglyrp1 A G 7: 18,884,946 E74G probably benign Het
R3hdm1 G T 1: 128,236,766 probably benign Het
Rap1gds1 T C 3: 138,927,614 T599A probably damaging Het
Rims1 A T 1: 22,288,612 M1273K probably damaging Het
Sbf1 G A 15: 89,303,112 R721* probably null Het
Slc17a1 T C 13: 23,880,717 I388T probably damaging Het
Sprn A C 7: 140,153,556 probably benign Het
Tango6 T C 8: 106,700,231 V459A possibly damaging Het
Tert C T 13: 73,627,820 T230I probably benign Het
Thada T C 17: 84,426,186 D1011G possibly damaging Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trip11 A T 12: 101,885,290 N838K possibly damaging Het
Ttn A G 2: 76,767,653 W19639R probably damaging Het
Ubr4 T A 4: 139,408,672 S924T probably benign Het
Upb1 A G 10: 75,415,027 E110G probably benign Het
Vegfa C T 17: 46,028,346 probably null Het
Vmn1r231 T C 17: 20,890,639 K5E possibly damaging Het
Vmn2r16 A T 5: 109,339,302 I130F probably benign Het
Wscd2 T A 5: 113,551,179 V82E probably benign Het
Zfp462 A G 4: 55,008,612 T193A probably benign Het
Zfp467 A G 6: 48,439,357 probably benign Het
Zfp619 T C 7: 39,536,988 L814P probably benign Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7436:Dzip3 UTSW 16 48951989 missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense probably damaging 0.99
R7964:Dzip3 UTSW 16 48951905 missense probably damaging 1.00
R8131:Dzip3 UTSW 16 48933793 critical splice donor site probably null
R8188:Dzip3 UTSW 16 48952136 missense probably damaging 1.00
R8209:Dzip3 UTSW 16 48977944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGCCTTGTGTTTACAGATGG -3'
(R):5'- GTGATAGCTGCCTCTGCTAG -3'

Sequencing Primer
(F):5'- GGCCTTGTGTTTACAGATGGAAAATC -3'
(R):5'- CCTCTGCTAGGCTAAATTTGAAACTC -3'
Posted On2015-10-21