Incidental Mutation 'R4696:Vmn1r231'
ID 355736
Institutional Source Beutler Lab
Gene Symbol Vmn1r231
Ensembl Gene ENSMUSG00000050933
Gene Name vomeronasal 1 receptor 231
Synonyms V1re7
MMRRC Submission 041946-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R4696 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 21109978-21110913 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21110901 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 5 (K5E)
Ref Sequence ENSEMBL: ENSMUSP00000056228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061278]
AlphaFold Q8R2A3
Predicted Effect possibly damaging
Transcript: ENSMUST00000061278
AA Change: K5E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056228
Gene: ENSMUSG00000050933
AA Change: K5E

DomainStartEndE-ValueType
Pfam:TAS2R 6 294 1.6e-13 PFAM
Pfam:V1R 36 297 1.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,241,817 (GRCm39) S1405G probably benign Het
Acaca T C 11: 84,171,261 (GRCm39) V1165A possibly damaging Het
Acin1 C A 14: 54,880,474 (GRCm39) probably benign Het
Akr1b8 G A 6: 34,340,312 (GRCm39) V159I probably benign Het
Alms1 T C 6: 85,597,504 (GRCm39) Y777H probably damaging Het
Cblc C A 7: 19,530,407 (GRCm39) G101C probably damaging Het
Cdc42ep5 G A 7: 4,154,614 (GRCm39) P58L possibly damaging Het
Cic A G 7: 24,987,908 (GRCm39) N1532S probably benign Het
Cipc T A 12: 86,999,714 (GRCm39) probably benign Het
Clca4b T C 3: 144,617,146 (GRCm39) I835V probably benign Het
Cntrob C T 11: 69,211,714 (GRCm39) G170D probably damaging Het
Col14a1 A G 15: 55,235,998 (GRCm39) Q304R unknown Het
Csmd3 T C 15: 47,777,364 (GRCm39) T1181A probably benign Het
Dchs1 A G 7: 105,413,834 (GRCm39) F994L probably damaging Het
Ddx42 C A 11: 106,138,529 (GRCm39) A776D probably benign Het
Disp2 G T 2: 118,622,165 (GRCm39) E966* probably null Het
Dmpk A T 7: 18,822,139 (GRCm39) N366Y probably damaging Het
Dmrt1 A G 19: 25,580,674 (GRCm39) Y362C possibly damaging Het
Dock10 C T 1: 80,493,330 (GRCm39) G1880D possibly damaging Het
Dzip1l A G 9: 99,545,664 (GRCm39) R638G possibly damaging Het
Dzip3 T A 16: 48,746,332 (GRCm39) probably benign Het
Ear-ps2 G A 14: 44,284,517 (GRCm39) noncoding transcript Het
Eno4 T C 19: 58,934,068 (GRCm39) S90P probably damaging Het
Epn2 C G 11: 61,426,129 (GRCm39) A283P probably damaging Het
Eya3 T A 4: 132,397,543 (GRCm39) Y67* probably null Het
Fat2 T C 11: 55,175,841 (GRCm39) N1624S probably benign Het
Fez1 T A 9: 36,781,766 (GRCm39) probably null Het
Fgfr1 T C 8: 26,053,504 (GRCm39) S260P probably damaging Het
Glb1 A G 9: 114,293,220 (GRCm39) S532G probably benign Het
Gm15455 A T 1: 33,876,874 (GRCm39) noncoding transcript Het
Grid2ip A G 5: 143,377,131 (GRCm39) probably benign Het
Guca2b C A 4: 119,513,996 (GRCm39) G129V probably damaging Het
Hes3 T C 4: 152,372,124 (GRCm39) E65G probably damaging Het
Itgbl1 T C 14: 124,204,120 (GRCm39) C404R probably damaging Het
Kansl1 C T 11: 104,247,593 (GRCm39) V586I possibly damaging Het
Krt18 A G 15: 101,940,293 (GRCm39) D390G probably benign Het
Laptm5 T C 4: 130,660,982 (GRCm39) probably benign Het
Lgals3bp C T 11: 118,288,977 (GRCm39) E116K probably benign Het
Lrrc39 C T 3: 116,363,769 (GRCm39) S114F probably damaging Het
Mfap3 T C 11: 57,419,117 (GRCm39) probably null Het
Nphp3 A G 9: 103,899,931 (GRCm39) H481R probably benign Het
Ntm T C 9: 29,090,501 (GRCm39) T73A possibly damaging Het
Or5m13b T A 2: 85,749,215 (GRCm39) probably null Het
Or8g4 T A 9: 39,662,024 (GRCm39) M114K probably damaging Het
Pbk G A 14: 66,049,386 (GRCm39) C21Y probably benign Het
Pglyrp1 A G 7: 18,618,871 (GRCm39) E74G probably benign Het
R3hdm1 G T 1: 128,164,503 (GRCm39) probably benign Het
Rap1gds1 T C 3: 138,633,375 (GRCm39) T599A probably damaging Het
Rigi A G 4: 40,203,798 (GRCm39) probably benign Het
Rims1 A T 1: 22,358,836 (GRCm39) M1273K probably damaging Het
Sbf1 G A 15: 89,187,315 (GRCm39) R721* probably null Het
Slc17a1 T C 13: 24,064,700 (GRCm39) I388T probably damaging Het
Sprn A C 7: 139,733,469 (GRCm39) probably benign Het
Tango6 T C 8: 107,426,863 (GRCm39) V459A possibly damaging Het
Tert C T 13: 73,775,939 (GRCm39) T230I probably benign Het
Thada T C 17: 84,733,614 (GRCm39) D1011G possibly damaging Het
Tln2 C T 9: 67,302,743 (GRCm39) R76Q probably damaging Het
Trip11 A T 12: 101,851,549 (GRCm39) N838K possibly damaging Het
Ttn A G 2: 76,597,997 (GRCm39) W19639R probably damaging Het
Ubr4 T A 4: 139,135,983 (GRCm39) S924T probably benign Het
Upb1 A G 10: 75,250,861 (GRCm39) E110G probably benign Het
Vegfa C T 17: 46,339,272 (GRCm39) probably null Het
Vmn2r16 A T 5: 109,487,168 (GRCm39) I130F probably benign Het
Wscd2 T A 5: 113,689,240 (GRCm39) V82E probably benign Het
Zfp462 A G 4: 55,008,612 (GRCm39) T193A probably benign Het
Zfp467 A G 6: 48,416,291 (GRCm39) probably benign Het
Zfp619 T C 7: 39,186,412 (GRCm39) L814P probably benign Het
Other mutations in Vmn1r231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r231 APN 17 21,110,828 (GRCm39) missense possibly damaging 0.68
IGL02124:Vmn1r231 APN 17 21,110,568 (GRCm39) missense probably damaging 1.00
IGL02151:Vmn1r231 APN 17 21,109,997 (GRCm39) missense probably benign 0.06
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0396:Vmn1r231 UTSW 17 21,110,661 (GRCm39) missense probably damaging 0.98
R0427:Vmn1r231 UTSW 17 21,110,490 (GRCm39) missense probably benign 0.05
R0470:Vmn1r231 UTSW 17 21,110,265 (GRCm39) nonsense probably null
R0848:Vmn1r231 UTSW 17 21,110,433 (GRCm39) missense probably damaging 1.00
R1692:Vmn1r231 UTSW 17 21,110,871 (GRCm39) missense probably benign 0.02
R1987:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R1988:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R2105:Vmn1r231 UTSW 17 21,110,380 (GRCm39) missense possibly damaging 0.66
R4440:Vmn1r231 UTSW 17 21,110,718 (GRCm39) missense possibly damaging 0.48
R4634:Vmn1r231 UTSW 17 21,110,660 (GRCm39) missense possibly damaging 0.46
R4646:Vmn1r231 UTSW 17 21,110,571 (GRCm39) missense probably damaging 1.00
R4678:Vmn1r231 UTSW 17 21,110,489 (GRCm39) missense possibly damaging 0.94
R4938:Vmn1r231 UTSW 17 21,110,613 (GRCm39) missense possibly damaging 0.76
R5544:Vmn1r231 UTSW 17 21,110,840 (GRCm39) missense probably damaging 1.00
R5942:Vmn1r231 UTSW 17 21,110,417 (GRCm39) missense possibly damaging 0.83
R6053:Vmn1r231 UTSW 17 21,110,081 (GRCm39) missense probably damaging 1.00
R6692:Vmn1r231 UTSW 17 21,110,745 (GRCm39) missense possibly damaging 0.46
R6712:Vmn1r231 UTSW 17 21,109,992 (GRCm39) missense possibly damaging 0.54
R7131:Vmn1r231 UTSW 17 21,110,140 (GRCm39) missense possibly damaging 0.87
R7854:Vmn1r231 UTSW 17 21,110,894 (GRCm39) missense probably damaging 0.98
R7918:Vmn1r231 UTSW 17 21,110,236 (GRCm39) nonsense probably null
R8187:Vmn1r231 UTSW 17 21,110,893 (GRCm39) missense probably benign 0.10
R8238:Vmn1r231 UTSW 17 21,110,640 (GRCm39) missense probably benign 0.08
R8313:Vmn1r231 UTSW 17 21,110,289 (GRCm39) missense probably benign 0.02
R8525:Vmn1r231 UTSW 17 21,110,001 (GRCm39) missense probably benign 0.06
R9276:Vmn1r231 UTSW 17 21,110,560 (GRCm39) missense probably benign 0.00
RF010:Vmn1r231 UTSW 17 21,110,255 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATCCCAAAAGTTTGCATTGTC -3'
(R):5'- GCAAGCTATTAGTGATGAGCAATTGC -3'

Sequencing Primer
(F):5'- CCCAAAAGTTTGCATTGTCTGTAGC -3'
(R):5'- GAGCAATTGCATTTCAAACAGG -3'
Posted On 2015-10-21