Incidental Mutation 'R4697:Hoxd10'
ID 355747
Institutional Source Beutler Lab
Gene Symbol Hoxd10
Ensembl Gene ENSMUSG00000050368
Gene Name homeobox D10
Synonyms Hox-4.5, Hox-5.3
MMRRC Submission 041947-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock # R4697 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 74691924-74695105 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 74694187 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 281 (L281*)
Ref Sequence ENSEMBL: ENSMUSP00000062412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059272] [ENSMUST00000061745]
AlphaFold P28359
Predicted Effect probably benign
Transcript: ENSMUST00000059272
SMART Domains Protein: ENSMUSP00000058490
Gene: ENSMUSG00000043342

DomainStartEndE-ValueType
Pfam:Hox9_act 1 126 2e-47 PFAM
low complexity region 155 176 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
low complexity region 248 256 N/A INTRINSIC
HOX 272 334 6.25e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000061745
AA Change: L281*
SMART Domains Protein: ENSMUSP00000062412
Gene: ENSMUSG00000050368
AA Change: L281*

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
HOX 266 328 3.3e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126966
SMART Domains Protein: ENSMUSP00000133930
Gene: ENSMUSG00000086077

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190845
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Abd-B homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox D genes located on chromosome 2. The encoded nuclear protein functions as a sequence-specific transcription factor that is expressed in the developing limb buds and is involved in differentiation and limb development. Mutations in this gene have been associated with Wilm's tumor and congenital vertical talus (also known as "rocker-bottom foot" deformity or congenital convex pes valgus) and/or a foot deformity resembling that seen in Charcot-Marie-Tooth disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit an abnormal gait associated with defects in sacral vertebrae (including homeotic transformations), hindlimb bones, and muscle innervation. These defects are sometimes seen in heterozygotes as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Hoxd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Hoxd10 APN 2 74692442 missense probably benign 0.06
IGL03206:Hoxd10 APN 2 74692432 nonsense probably null
hockey UTSW 2 74694163 missense probably damaging 1.00
R0375:Hoxd10 UTSW 2 74692720 missense probably benign 0.03
R3004:Hoxd10 UTSW 2 74692362 missense probably benign
R3419:Hoxd10 UTSW 2 74692577 missense probably benign 0.00
R3717:Hoxd10 UTSW 2 74694130 missense probably damaging 0.96
R4627:Hoxd10 UTSW 2 74692292 missense probably benign
R5875:Hoxd10 UTSW 2 74692082 missense possibly damaging 0.95
R6378:Hoxd10 UTSW 2 74694334 missense possibly damaging 0.93
R6597:Hoxd10 UTSW 2 74692640 missense probably benign 0.00
R6711:Hoxd10 UTSW 2 74694163 missense probably damaging 1.00
R6841:Hoxd10 UTSW 2 74692272 missense probably benign 0.13
R8503:Hoxd10 UTSW 2 74692380 missense probably benign 0.06
R9229:Hoxd10 UTSW 2 74694256 missense possibly damaging 0.90
R9342:Hoxd10 UTSW 2 74692638 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTCCAAAGCAGCCCATC -3'
(R):5'- TGGGCCTCAGACCTAAGAAAAG -3'

Sequencing Primer
(F):5'- ATCTGGCAGCAGGGTCATG -3'
(R):5'- CCTAAGAAAAGGTGAGGTTGGC -3'
Posted On 2015-10-21