Incidental Mutation 'R4697:Qser1'
ID 355751
Institutional Source Beutler Lab
Gene Symbol Qser1
Ensembl Gene ENSMUSG00000074994
Gene Name glutamine and serine rich 1
Synonyms 4732486I23Rik
MMRRC Submission 041947-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.693) question?
Stock # R4697 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 104585140-104647105 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104617528 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1005 (S1005G)
Ref Sequence ENSEMBL: ENSMUSP00000114062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117237] [ENSMUST00000231375]
AlphaFold A0A338P6K9
Predicted Effect probably benign
Transcript: ENSMUST00000117237
AA Change: S1005G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114062
Gene: ENSMUSG00000074994
AA Change: S1005G

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 697 713 N/A INTRINSIC
low complexity region 1037 1050 N/A INTRINSIC
low complexity region 1420 1449 N/A INTRINSIC
Pfam:DUF4211 1470 1616 1e-26 PFAM
low complexity region 1631 1647 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231375
AA Change: S1095G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,615,243 (GRCm39) M1T probably null Het
Aatf T A 11: 84,339,964 (GRCm39) D449V probably damaging Het
Acbd3 T A 1: 180,549,509 (GRCm39) probably benign Het
Bicc1 T A 10: 70,789,314 (GRCm39) I366F possibly damaging Het
Ccdc74a T C 16: 17,467,613 (GRCm39) S184P possibly damaging Het
Cntn4 T C 6: 106,502,446 (GRCm39) V401A probably damaging Het
Cux2 T C 5: 122,011,816 (GRCm39) T540A probably damaging Het
Disp2 G T 2: 118,622,165 (GRCm39) E966* probably null Het
Dpp7 A G 2: 25,244,931 (GRCm39) Y209H probably benign Het
Dstyk T A 1: 132,377,225 (GRCm39) F277Y probably damaging Het
Dtx1 A T 5: 120,832,473 (GRCm39) probably null Het
Ear-ps2 G A 14: 44,284,517 (GRCm39) noncoding transcript Het
Ednra T C 8: 78,391,624 (GRCm39) H422R probably benign Het
Erlec1 T A 11: 30,902,640 (GRCm39) I67F probably benign Het
Fam161b G A 12: 84,395,332 (GRCm39) probably benign Het
Gata5 A T 2: 179,969,172 (GRCm39) C345* probably null Het
Glmp T C 3: 88,235,581 (GRCm39) V47A probably damaging Het
Gm9762 T A 3: 78,873,857 (GRCm39) noncoding transcript Het
Gnas A T 2: 174,139,873 (GRCm39) D14V probably damaging Het
Gnl3 T C 14: 30,739,286 (GRCm39) S53G probably damaging Het
Grhl3 C T 4: 135,275,777 (GRCm39) V527M probably damaging Het
Hoxd10 T A 2: 74,524,531 (GRCm39) L281* probably null Het
Kif16b T G 2: 142,532,614 (GRCm39) Y1175S probably benign Het
Kif2b A G 11: 91,467,672 (GRCm39) S204P probably benign Het
Klhl40 T A 9: 121,607,800 (GRCm39) I320N probably damaging Het
Ksr2 G A 5: 117,846,212 (GRCm39) R693Q probably damaging Het
Mis12 A G 11: 70,916,152 (GRCm39) K62E possibly damaging Het
Mlc1 A G 15: 88,858,980 (GRCm39) C102R probably damaging Het
Muc5b T C 7: 141,411,098 (GRCm39) I1348T unknown Het
Myh7b A G 2: 155,471,242 (GRCm39) E1130G probably damaging Het
Nat8f4 T C 6: 85,878,368 (GRCm39) T52A probably benign Het
Nxpe2 C A 9: 48,231,821 (GRCm39) V379L probably benign Het
Or10ad1c G A 15: 98,084,749 (GRCm39) R310W probably damaging Het
Or4c1 C A 2: 89,133,246 (GRCm39) S230I possibly damaging Het
Or4c1 T A 2: 89,133,247 (GRCm39) S230C probably damaging Het
Or5b111 A T 19: 13,291,081 (GRCm39) D189E probably benign Het
Or5b12 C T 19: 12,897,298 (GRCm39) C125Y probably damaging Het
Pcdhga7 A T 18: 37,850,261 (GRCm39) Y756F probably damaging Het
Pcsk6 T A 7: 65,608,989 (GRCm39) Y284N probably damaging Het
Pdcd11 T C 19: 47,114,786 (GRCm39) V1367A possibly damaging Het
Postn T A 3: 54,282,492 (GRCm39) N484K probably damaging Het
Prkd3 C T 17: 79,268,600 (GRCm39) V572I probably benign Het
Radil G T 5: 142,472,556 (GRCm39) D951E probably benign Het
Ripk1 C T 13: 34,211,925 (GRCm39) R352* probably null Het
Sacs T C 14: 61,450,196 (GRCm39) F4081L probably benign Het
Sbf1 A G 15: 89,199,288 (GRCm39) V11A possibly damaging Het
Sgip1 T A 4: 102,791,784 (GRCm39) F536I probably damaging Het
Slc45a1 A G 4: 150,722,741 (GRCm39) L381P probably damaging Het
Smarcad1 C T 6: 65,029,625 (GRCm39) P71L probably benign Het
Spns1 T A 7: 125,976,209 (GRCm39) D14V probably damaging Het
Sv2c T A 13: 96,122,526 (GRCm39) I417F possibly damaging Het
Tas2r113 T A 6: 132,870,479 (GRCm39) M169K probably benign Het
Tgm1 A T 14: 55,943,138 (GRCm39) N567K probably benign Het
Thoc2l A G 5: 104,670,106 (GRCm39) K1543E probably benign Het
Tln2 C T 9: 67,302,743 (GRCm39) R76Q probably damaging Het
Trpm6 T C 19: 18,831,155 (GRCm39) V1340A probably benign Het
Tspan18 A T 2: 93,142,375 (GRCm39) probably null Het
Txndc11 C T 16: 10,902,178 (GRCm39) V679I probably damaging Het
Usf1 G T 1: 171,244,532 (GRCm39) G144V possibly damaging Het
Vmn1r59 T C 7: 5,457,451 (GRCm39) Y103C probably damaging Het
Vmn2r23 A T 6: 123,718,785 (GRCm39) I713F probably damaging Het
Vmn2r79 A T 7: 86,687,168 (GRCm39) I850F probably damaging Het
Vps35l T A 7: 118,390,671 (GRCm39) I455N probably damaging Het
Wdr90 C T 17: 26,074,337 (GRCm39) R676H probably benign Het
Zfp867 G A 11: 59,354,487 (GRCm39) R281W probably damaging Het
Zfp939 T C 7: 39,122,366 (GRCm39) noncoding transcript Het
Other mutations in Qser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Qser1 APN 2 104,596,401 (GRCm39) missense probably damaging 1.00
IGL00402:Qser1 APN 2 104,617,326 (GRCm39) missense probably benign 0.00
IGL00417:Qser1 APN 2 104,617,248 (GRCm39) missense probably damaging 1.00
IGL00756:Qser1 APN 2 104,618,016 (GRCm39) missense possibly damaging 0.55
IGL01304:Qser1 APN 2 104,617,976 (GRCm39) missense probably damaging 0.99
IGL01317:Qser1 APN 2 104,617,324 (GRCm39) missense probably damaging 0.99
IGL02186:Qser1 APN 2 104,618,606 (GRCm39) missense probably damaging 1.00
IGL03236:Qser1 APN 2 104,616,877 (GRCm39) missense probably benign 0.35
IGL03365:Qser1 APN 2 104,617,344 (GRCm39) missense probably damaging 1.00
Behoove UTSW 2 104,617,322 (GRCm39) nonsense probably null
I1329:Qser1 UTSW 2 104,617,322 (GRCm39) nonsense probably null
R0270:Qser1 UTSW 2 104,619,306 (GRCm39) missense probably benign 0.03
R0395:Qser1 UTSW 2 104,593,226 (GRCm39) missense probably damaging 1.00
R0523:Qser1 UTSW 2 104,620,021 (GRCm39) missense probably damaging 1.00
R0727:Qser1 UTSW 2 104,607,656 (GRCm39) splice site probably benign
R1037:Qser1 UTSW 2 104,590,900 (GRCm39) missense probably damaging 0.99
R1222:Qser1 UTSW 2 104,607,776 (GRCm39) missense probably damaging 1.00
R1418:Qser1 UTSW 2 104,607,776 (GRCm39) missense probably damaging 1.00
R1891:Qser1 UTSW 2 104,620,444 (GRCm39) missense probably benign
R1974:Qser1 UTSW 2 104,590,886 (GRCm39) missense probably damaging 1.00
R2200:Qser1 UTSW 2 104,619,358 (GRCm39) missense probably damaging 1.00
R4179:Qser1 UTSW 2 104,606,729 (GRCm39) missense probably benign 0.19
R4379:Qser1 UTSW 2 104,596,404 (GRCm39) splice site probably null
R4418:Qser1 UTSW 2 104,619,766 (GRCm39) missense probably damaging 1.00
R4585:Qser1 UTSW 2 104,617,138 (GRCm39) missense probably benign 0.01
R4749:Qser1 UTSW 2 104,617,649 (GRCm39) missense probably benign 0.16
R4775:Qser1 UTSW 2 104,620,246 (GRCm39) missense probably damaging 1.00
R5010:Qser1 UTSW 2 104,618,176 (GRCm39) missense possibly damaging 0.67
R5070:Qser1 UTSW 2 104,617,627 (GRCm39) missense possibly damaging 0.49
R5268:Qser1 UTSW 2 104,617,776 (GRCm39) missense possibly damaging 0.47
R5384:Qser1 UTSW 2 104,616,987 (GRCm39) missense probably damaging 1.00
R5400:Qser1 UTSW 2 104,620,219 (GRCm39) missense probably damaging 1.00
R5502:Qser1 UTSW 2 104,616,919 (GRCm39) missense probably benign 0.00
R5615:Qser1 UTSW 2 104,620,039 (GRCm39) missense possibly damaging 0.78
R5664:Qser1 UTSW 2 104,608,541 (GRCm39) missense probably damaging 1.00
R5750:Qser1 UTSW 2 104,619,268 (GRCm39) missense probably damaging 1.00
R5793:Qser1 UTSW 2 104,593,205 (GRCm39) missense probably damaging 1.00
R6035:Qser1 UTSW 2 104,617,468 (GRCm39) missense probably damaging 0.99
R6035:Qser1 UTSW 2 104,617,468 (GRCm39) missense probably damaging 0.99
R6171:Qser1 UTSW 2 104,619,628 (GRCm39) missense probably damaging 1.00
R6223:Qser1 UTSW 2 104,617,993 (GRCm39) missense probably benign 0.01
R6254:Qser1 UTSW 2 104,620,435 (GRCm39) missense probably benign 0.07
R6303:Qser1 UTSW 2 104,593,175 (GRCm39) missense probably damaging 1.00
R6653:Qser1 UTSW 2 104,610,605 (GRCm39) missense possibly damaging 0.85
R6703:Qser1 UTSW 2 104,607,670 (GRCm39) missense possibly damaging 0.50
R6970:Qser1 UTSW 2 104,618,475 (GRCm39) missense probably benign 0.25
R7064:Qser1 UTSW 2 104,617,464 (GRCm39) missense probably damaging 1.00
R7478:Qser1 UTSW 2 104,619,859 (GRCm39) missense probably damaging 1.00
R7643:Qser1 UTSW 2 104,617,322 (GRCm39) nonsense probably null
R7769:Qser1 UTSW 2 104,588,921 (GRCm39) missense possibly damaging 0.65
R7836:Qser1 UTSW 2 104,606,579 (GRCm39) missense probably damaging 1.00
R7938:Qser1 UTSW 2 104,619,312 (GRCm39) missense probably damaging 1.00
R8209:Qser1 UTSW 2 104,619,070 (GRCm39) missense probably benign 0.02
R8218:Qser1 UTSW 2 104,593,268 (GRCm39) missense probably damaging 1.00
R8226:Qser1 UTSW 2 104,619,070 (GRCm39) missense probably benign 0.02
R8341:Qser1 UTSW 2 104,619,820 (GRCm39) missense probably damaging 0.99
R8362:Qser1 UTSW 2 104,620,246 (GRCm39) missense probably damaging 1.00
R8785:Qser1 UTSW 2 104,618,098 (GRCm39) missense probably damaging 0.99
R8983:Qser1 UTSW 2 104,617,702 (GRCm39) missense probably benign 0.02
R9051:Qser1 UTSW 2 104,593,292 (GRCm39) missense possibly damaging 0.52
R9165:Qser1 UTSW 2 104,618,815 (GRCm39) missense probably benign 0.41
R9289:Qser1 UTSW 2 104,617,593 (GRCm39) missense possibly damaging 0.48
R9342:Qser1 UTSW 2 104,618,164 (GRCm39) missense probably benign 0.00
R9380:Qser1 UTSW 2 104,619,691 (GRCm39) nonsense probably null
R9736:Qser1 UTSW 2 104,619,988 (GRCm39) missense probably benign 0.00
T0722:Qser1 UTSW 2 104,617,177 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CATTGAGCAGACCTTTTCAGC -3'
(R):5'- GACTGGGTCAGGAAATCCAG -3'

Sequencing Primer
(F):5'- AGCAGACCTTTTCAGCTGTTTTTG -3'
(R):5'- GTTCTGACCCATTCAAGAAACAGTTG -3'
Posted On 2015-10-21