Mutagenetix > Incidental Mutations

Incidental Mutation 'R4697:Postn'

355756

Institutional Source

Beutler Lab

Gene Symbol

Postn

Ensembl Gene

ENSMUSG00000027750

Gene Name

periostin, osteoblast specific factor

Synonyms

peri, A630052E07Rik, OSF-2, Osf2, Periostin

MMRRC Submission

041947-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54361109-54391037 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 54375071 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 484 (N484K)

Ref Sequence

ENSEMBL: ENSMUSP00000112735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]

Predicted Effect

probably damaging
Transcript: ENSMUST00000073012
AA Change: N484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750
AA Change: N484K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FAS1	135	235	7.81e-30	SMART
FAS1	272	370	2.31e-32	SMART
FAS1	406	497	2.43e-17	SMART
FAS1	534	633	2.5e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000081564
AA Change: N484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750
AA Change: N484K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FAS1	135	235	7.81e-30	SMART
FAS1	272	370	2.31e-32	SMART
FAS1	406	497	2.43e-17	SMART
FAS1	534	633	2.5e-28	SMART
low complexity region	669	680	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107985
AA Change: N484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750
AA Change: N484K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FAS1	135	235	7.81e-30	SMART
FAS1	272	370	2.31e-32	SMART
FAS1	406	497	2.43e-17	SMART
FAS1	534	633	2.5e-28	SMART
low complexity region	669	680	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117373
AA Change: N484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750
AA Change: N484K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FAS1	135	235	7.81e-30	SMART
FAS1	272	370	2.31e-32	SMART
FAS1	406	497	2.43e-17	SMART
FAS1	534	633	2.5e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143258

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145036

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,791,448	I455N	probably damaging	Het
A2m	T	C	6: 121,638,284	M1T	probably null	Het
Aatf	T	A	11: 84,449,138	D449V	probably damaging	Het
Acbd3	T	A	1: 180,721,944		probably benign	Het
BC005561	A	G	5: 104,522,240	K1543E	probably benign	Het
Bicc1	T	A	10: 70,953,484	I366F	possibly damaging	Het
Ccdc74a	T	C	16: 17,649,749	S184P	possibly damaging	Het
Cntn4	T	C	6: 106,525,485	V401A	probably damaging	Het
Cux2	T	C	5: 121,873,753	T540A	probably damaging	Het
Disp2	G	T	2: 118,791,684	E966*	probably null	Het
Dpp7	A	G	2: 25,354,919	Y209H	probably benign	Het
Dstyk	T	A	1: 132,449,487	F277Y	probably damaging	Het
Dtx1	A	T	5: 120,694,408		probably null	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Ednra	T	C	8: 77,664,995	H422R	probably benign	Het
Erlec1	T	A	11: 30,952,640	I67F	probably benign	Het
Fam161b	G	A	12: 84,348,558		probably benign	Het
Gata5	A	T	2: 180,327,379	C345*	probably null	Het
Glmp	T	C	3: 88,328,274	V47A	probably damaging	Het
Gm9762	T	A	3: 78,966,550		noncoding transcript	Het
Gnas	A	T	2: 174,298,080	D14V	probably damaging	Het
Gnl3	T	C	14: 31,017,329	S53G	probably damaging	Het
Grhl3	C	T	4: 135,548,466	V527M	probably damaging	Het
Hoxd10	T	A	2: 74,694,187	L281*	probably null	Het
Kif16b	T	G	2: 142,690,694	Y1175S	probably benign	Het
Kif2b	A	G	11: 91,576,846	S204P	probably benign	Het
Klhl40	T	A	9: 121,778,734	I320N	probably damaging	Het
Ksr2	G	A	5: 117,708,147	R693Q	probably damaging	Het
Mis12	A	G	11: 71,025,326	K62E	possibly damaging	Het
Mlc1	A	G	15: 88,974,777	C102R	probably damaging	Het
Muc5b	T	C	7: 141,857,361	I1348T	unknown	Het
Myh7b	A	G	2: 155,629,322	E1130G	probably damaging	Het
Nat8f4	T	C	6: 85,901,386	T52A	probably benign	Het
Nxpe2	C	A	9: 48,320,521	V379L	probably benign	Het
Olfr1231	C	A	2: 89,302,902	S230I	possibly damaging	Het
Olfr1231	T	A	2: 89,302,903	S230C	probably damaging	Het
Olfr1448	C	T	19: 12,919,934	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,313,717	D189E	probably benign	Het
Olfr288	G	A	15: 98,186,868	R310W	probably damaging	Het
Pcdhga7	A	T	18: 37,717,208	Y756F	probably damaging	Het
Pcsk6	T	A	7: 65,959,241	Y284N	probably damaging	Het
Pdcd11	T	C	19: 47,126,347	V1367A	possibly damaging	Het
Prkd3	C	T	17: 78,961,171	V572I	probably benign	Het
Qser1	T	C	2: 104,787,183	S1005G	probably benign	Het
Radil	G	T	5: 142,486,801	D951E	probably benign	Het
Ripk1	C	T	13: 34,027,942	R352*	probably null	Het
Sacs	T	C	14: 61,212,747	F4081L	probably benign	Het
Sbf1	A	G	15: 89,315,085	V11A	possibly damaging	Het
Sgip1	T	A	4: 102,934,587	F536I	probably damaging	Het
Slc45a1	A	G	4: 150,638,284	L381P	probably damaging	Het
Smarcad1	C	T	6: 65,052,641	P71L	probably benign	Het
Spns1	T	A	7: 126,377,037	D14V	probably damaging	Het
Sv2c	T	A	13: 95,986,018	I417F	possibly damaging	Het
Tas2r113	T	A	6: 132,893,516	M169K	probably benign	Het
Tgm1	A	T	14: 55,705,681	N567K	probably benign	Het
Tln2	C	T	9: 67,395,461	R76Q	probably damaging	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Tspan18	A	T	2: 93,312,030		probably null	Het
Txndc11	C	T	16: 11,084,314	V679I	probably damaging	Het
Usf1	G	T	1: 171,416,964	G144V	possibly damaging	Het
Vmn1r59	T	C	7: 5,454,452	Y103C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,826	I713F	probably damaging	Het
Vmn2r79	A	T	7: 87,037,960	I850F	probably damaging	Het
Wdr90	C	T	17: 25,855,363	R676H	probably benign	Het
Zfp867	G	A	11: 59,463,661	R281W	probably damaging	Het
Zfp939	T	C	7: 39,472,942		noncoding transcript	Het

Other mutations in Postn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Postn	APN	3	54373728	missense	probably damaging	1.00
IGL00567:Postn	APN	3	54384523	missense	probably benign
IGL00742:Postn	APN	3	54372894	missense	possibly damaging	0.81
IGL00971:Postn	APN	3	54369276	missense	possibly damaging	0.88
IGL01105:Postn	APN	3	54362710	missense	probably damaging	1.00
IGL01460:Postn	APN	3	54375158	unclassified	probably benign
IGL01609:Postn	APN	3	54369228	missense	probably damaging	0.99
IGL01878:Postn	APN	3	54383480	splice site	probably null
IGL01885:Postn	APN	3	54376034	unclassified	probably benign
IGL02040:Postn	APN	3	54362689	missense	probably benign
IGL02431:Postn	APN	3	54375096	missense	probably damaging	0.99
IGL02578:Postn	APN	3	54377204	missense	possibly damaging	0.93
IGL02943:Postn	APN	3	54377608	critical splice donor site	probably null
IGL03307:Postn	APN	3	54375127	missense	probably benign	0.32
sticklike	UTSW	3	54372106	missense	probably damaging	1.00
R0117:Postn	UTSW	3	54383481	splice site	probably benign
R0270:Postn	UTSW	3	54384550	missense	probably damaging	0.98
R0410:Postn	UTSW	3	54385277	missense	possibly damaging	0.93
R0548:Postn	UTSW	3	54367576	nonsense	probably null
R0734:Postn	UTSW	3	54362715	missense	probably damaging	1.00
R1648:Postn	UTSW	3	54376101	missense	probably damaging	1.00
R1796:Postn	UTSW	3	54373756	missense	probably damaging	1.00
R1823:Postn	UTSW	3	54385287	critical splice donor site	probably null
R1938:Postn	UTSW	3	54377612	splice site	probably null
R2311:Postn	UTSW	3	54385223	missense	probably damaging	0.98
R2566:Postn	UTSW	3	54376953	missense	probably damaging	0.97
R2938:Postn	UTSW	3	54370310	missense	probably damaging	1.00
R4105:Postn	UTSW	3	54376041	missense	probably damaging	1.00
R4394:Postn	UTSW	3	54370955	missense	probably damaging	1.00
R4620:Postn	UTSW	3	54376993	missense	probably damaging	1.00
R4628:Postn	UTSW	3	54372157	missense	probably damaging	1.00
R4709:Postn	UTSW	3	54384610	intron	probably benign
R4952:Postn	UTSW	3	54390315	utr 3 prime	probably benign
R5303:Postn	UTSW	3	54377597	missense	probably damaging	1.00
R5704:Postn	UTSW	3	54372106	missense	probably damaging	1.00
R5902:Postn	UTSW	3	54372089	missense	probably benign	0.03
R5914:Postn	UTSW	3	54373800	nonsense	probably null
R6032:Postn	UTSW	3	54376716	missense	possibly damaging	0.53
R6032:Postn	UTSW	3	54376716	missense	possibly damaging	0.53
R6101:Postn	UTSW	3	54372220	splice site	probably null
R6105:Postn	UTSW	3	54372220	splice site	probably null
R6334:Postn	UTSW	3	54385282	missense	probably benign
R7131:Postn	UTSW	3	54362635	missense	probably damaging	1.00
R7322:Postn	UTSW	3	54370280	missense	probably damaging	1.00
R7430:Postn	UTSW	3	54370202	missense	probably damaging	1.00
R7497:Postn	UTSW	3	54362670	missense	probably damaging	1.00
R8245:Postn	UTSW	3	54376047	missense	probably null	0.99
R8350:Postn	UTSW	3	54370258	missense	probably damaging	1.00
R8748:Postn	UTSW	3	54389339	missense	probably damaging	0.97
RF018:Postn	UTSW	3	54384492	missense	probably damaging	0.96
X0004:Postn	UTSW	3	54362694	missense	probably damaging	1.00
X0022:Postn	UTSW	3	54370840	missense	probably benign	0.03
Z1088:Postn	UTSW	3	54375127	missense	probably benign	0.32

Predicted Primers

PCR Primer
(F):5'- GCACAGTCAAATGTTCAAGACA -3'
(R):5'- CAAACCAAATATCATTGAAACGTGT -3'

Sequencing Primer
(F):5'- TGTTCAAGACATTACAAACAAGAGAG -3'
(R):5'- CTCTTCACTGGAGAAGGCTGATTC -3'

Posted On

2015-10-21