Incidental Mutation 'R4697:Postn'
ID 355756
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Name periostin, osteoblast specific factor
Synonyms A630052E07Rik, peri, Periostin, Osf2, OSF-2
MMRRC Submission 041947-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4697 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 54268530-54298458 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54282492 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 484 (N484K)
Ref Sequence ENSEMBL: ENSMUSP00000112735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
AlphaFold Q62009
Predicted Effect probably damaging
Transcript: ENSMUST00000073012
AA Change: N484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750
AA Change: N484K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081564
AA Change: N484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750
AA Change: N484K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107985
AA Change: N484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750
AA Change: N484K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117373
AA Change: N484K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750
AA Change: N484K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145036
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,615,243 (GRCm39) M1T probably null Het
Aatf T A 11: 84,339,964 (GRCm39) D449V probably damaging Het
Acbd3 T A 1: 180,549,509 (GRCm39) probably benign Het
Bicc1 T A 10: 70,789,314 (GRCm39) I366F possibly damaging Het
Ccdc74a T C 16: 17,467,613 (GRCm39) S184P possibly damaging Het
Cntn4 T C 6: 106,502,446 (GRCm39) V401A probably damaging Het
Cux2 T C 5: 122,011,816 (GRCm39) T540A probably damaging Het
Disp2 G T 2: 118,622,165 (GRCm39) E966* probably null Het
Dpp7 A G 2: 25,244,931 (GRCm39) Y209H probably benign Het
Dstyk T A 1: 132,377,225 (GRCm39) F277Y probably damaging Het
Dtx1 A T 5: 120,832,473 (GRCm39) probably null Het
Ear-ps2 G A 14: 44,284,517 (GRCm39) noncoding transcript Het
Ednra T C 8: 78,391,624 (GRCm39) H422R probably benign Het
Erlec1 T A 11: 30,902,640 (GRCm39) I67F probably benign Het
Fam161b G A 12: 84,395,332 (GRCm39) probably benign Het
Gata5 A T 2: 179,969,172 (GRCm39) C345* probably null Het
Glmp T C 3: 88,235,581 (GRCm39) V47A probably damaging Het
Gm9762 T A 3: 78,873,857 (GRCm39) noncoding transcript Het
Gnas A T 2: 174,139,873 (GRCm39) D14V probably damaging Het
Gnl3 T C 14: 30,739,286 (GRCm39) S53G probably damaging Het
Grhl3 C T 4: 135,275,777 (GRCm39) V527M probably damaging Het
Hoxd10 T A 2: 74,524,531 (GRCm39) L281* probably null Het
Kif16b T G 2: 142,532,614 (GRCm39) Y1175S probably benign Het
Kif2b A G 11: 91,467,672 (GRCm39) S204P probably benign Het
Klhl40 T A 9: 121,607,800 (GRCm39) I320N probably damaging Het
Ksr2 G A 5: 117,846,212 (GRCm39) R693Q probably damaging Het
Mis12 A G 11: 70,916,152 (GRCm39) K62E possibly damaging Het
Mlc1 A G 15: 88,858,980 (GRCm39) C102R probably damaging Het
Muc5b T C 7: 141,411,098 (GRCm39) I1348T unknown Het
Myh7b A G 2: 155,471,242 (GRCm39) E1130G probably damaging Het
Nat8f4 T C 6: 85,878,368 (GRCm39) T52A probably benign Het
Nxpe2 C A 9: 48,231,821 (GRCm39) V379L probably benign Het
Or10ad1c G A 15: 98,084,749 (GRCm39) R310W probably damaging Het
Or4c1 C A 2: 89,133,246 (GRCm39) S230I possibly damaging Het
Or4c1 T A 2: 89,133,247 (GRCm39) S230C probably damaging Het
Or5b111 A T 19: 13,291,081 (GRCm39) D189E probably benign Het
Or5b12 C T 19: 12,897,298 (GRCm39) C125Y probably damaging Het
Pcdhga7 A T 18: 37,850,261 (GRCm39) Y756F probably damaging Het
Pcsk6 T A 7: 65,608,989 (GRCm39) Y284N probably damaging Het
Pdcd11 T C 19: 47,114,786 (GRCm39) V1367A possibly damaging Het
Prkd3 C T 17: 79,268,600 (GRCm39) V572I probably benign Het
Qser1 T C 2: 104,617,528 (GRCm39) S1005G probably benign Het
Radil G T 5: 142,472,556 (GRCm39) D951E probably benign Het
Ripk1 C T 13: 34,211,925 (GRCm39) R352* probably null Het
Sacs T C 14: 61,450,196 (GRCm39) F4081L probably benign Het
Sbf1 A G 15: 89,199,288 (GRCm39) V11A possibly damaging Het
Sgip1 T A 4: 102,791,784 (GRCm39) F536I probably damaging Het
Slc45a1 A G 4: 150,722,741 (GRCm39) L381P probably damaging Het
Smarcad1 C T 6: 65,029,625 (GRCm39) P71L probably benign Het
Spns1 T A 7: 125,976,209 (GRCm39) D14V probably damaging Het
Sv2c T A 13: 96,122,526 (GRCm39) I417F possibly damaging Het
Tas2r113 T A 6: 132,870,479 (GRCm39) M169K probably benign Het
Tgm1 A T 14: 55,943,138 (GRCm39) N567K probably benign Het
Thoc2l A G 5: 104,670,106 (GRCm39) K1543E probably benign Het
Tln2 C T 9: 67,302,743 (GRCm39) R76Q probably damaging Het
Trpm6 T C 19: 18,831,155 (GRCm39) V1340A probably benign Het
Tspan18 A T 2: 93,142,375 (GRCm39) probably null Het
Txndc11 C T 16: 10,902,178 (GRCm39) V679I probably damaging Het
Usf1 G T 1: 171,244,532 (GRCm39) G144V possibly damaging Het
Vmn1r59 T C 7: 5,457,451 (GRCm39) Y103C probably damaging Het
Vmn2r23 A T 6: 123,718,785 (GRCm39) I713F probably damaging Het
Vmn2r79 A T 7: 86,687,168 (GRCm39) I850F probably damaging Het
Vps35l T A 7: 118,390,671 (GRCm39) I455N probably damaging Het
Wdr90 C T 17: 26,074,337 (GRCm39) R676H probably benign Het
Zfp867 G A 11: 59,354,487 (GRCm39) R281W probably damaging Het
Zfp939 T C 7: 39,122,366 (GRCm39) noncoding transcript Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54,281,149 (GRCm39) missense probably damaging 1.00
IGL00567:Postn APN 3 54,291,944 (GRCm39) missense probably benign
IGL00742:Postn APN 3 54,280,315 (GRCm39) missense possibly damaging 0.81
IGL00971:Postn APN 3 54,276,697 (GRCm39) missense possibly damaging 0.88
IGL01105:Postn APN 3 54,270,131 (GRCm39) missense probably damaging 1.00
IGL01460:Postn APN 3 54,282,579 (GRCm39) unclassified probably benign
IGL01609:Postn APN 3 54,276,649 (GRCm39) missense probably damaging 0.99
IGL01878:Postn APN 3 54,290,901 (GRCm39) splice site probably null
IGL01885:Postn APN 3 54,283,455 (GRCm39) unclassified probably benign
IGL02040:Postn APN 3 54,270,110 (GRCm39) missense probably benign
IGL02431:Postn APN 3 54,282,517 (GRCm39) missense probably damaging 0.99
IGL02578:Postn APN 3 54,284,625 (GRCm39) missense possibly damaging 0.93
IGL02943:Postn APN 3 54,285,029 (GRCm39) critical splice donor site probably null
IGL03307:Postn APN 3 54,282,548 (GRCm39) missense probably benign 0.32
sticklike UTSW 3 54,279,527 (GRCm39) missense probably damaging 1.00
R0117:Postn UTSW 3 54,290,902 (GRCm39) splice site probably benign
R0270:Postn UTSW 3 54,291,971 (GRCm39) missense probably damaging 0.98
R0410:Postn UTSW 3 54,292,698 (GRCm39) missense possibly damaging 0.93
R0548:Postn UTSW 3 54,274,997 (GRCm39) nonsense probably null
R0734:Postn UTSW 3 54,270,136 (GRCm39) missense probably damaging 1.00
R1648:Postn UTSW 3 54,283,522 (GRCm39) missense probably damaging 1.00
R1796:Postn UTSW 3 54,281,177 (GRCm39) missense probably damaging 1.00
R1823:Postn UTSW 3 54,292,708 (GRCm39) critical splice donor site probably null
R1938:Postn UTSW 3 54,285,033 (GRCm39) splice site probably null
R2311:Postn UTSW 3 54,292,644 (GRCm39) missense probably damaging 0.98
R2566:Postn UTSW 3 54,284,374 (GRCm39) missense probably damaging 0.97
R2938:Postn UTSW 3 54,277,731 (GRCm39) missense probably damaging 1.00
R4105:Postn UTSW 3 54,283,462 (GRCm39) missense probably damaging 1.00
R4394:Postn UTSW 3 54,278,376 (GRCm39) missense probably damaging 1.00
R4620:Postn UTSW 3 54,284,414 (GRCm39) missense probably damaging 1.00
R4628:Postn UTSW 3 54,279,578 (GRCm39) missense probably damaging 1.00
R4709:Postn UTSW 3 54,292,031 (GRCm39) intron probably benign
R4952:Postn UTSW 3 54,297,736 (GRCm39) utr 3 prime probably benign
R5303:Postn UTSW 3 54,285,018 (GRCm39) missense probably damaging 1.00
R5704:Postn UTSW 3 54,279,527 (GRCm39) missense probably damaging 1.00
R5902:Postn UTSW 3 54,279,510 (GRCm39) missense probably benign 0.03
R5914:Postn UTSW 3 54,281,221 (GRCm39) nonsense probably null
R6032:Postn UTSW 3 54,284,137 (GRCm39) missense possibly damaging 0.53
R6032:Postn UTSW 3 54,284,137 (GRCm39) missense possibly damaging 0.53
R6101:Postn UTSW 3 54,279,641 (GRCm39) splice site probably null
R6105:Postn UTSW 3 54,279,641 (GRCm39) splice site probably null
R6334:Postn UTSW 3 54,292,703 (GRCm39) missense probably benign
R7131:Postn UTSW 3 54,270,056 (GRCm39) missense probably damaging 1.00
R7322:Postn UTSW 3 54,277,701 (GRCm39) missense probably damaging 1.00
R7430:Postn UTSW 3 54,277,623 (GRCm39) missense probably damaging 1.00
R7497:Postn UTSW 3 54,270,091 (GRCm39) missense probably damaging 1.00
R8245:Postn UTSW 3 54,283,468 (GRCm39) missense probably null 0.99
R8350:Postn UTSW 3 54,277,679 (GRCm39) missense probably damaging 1.00
R8748:Postn UTSW 3 54,296,760 (GRCm39) missense probably damaging 0.97
R9221:Postn UTSW 3 54,282,515 (GRCm39) missense possibly damaging 0.79
R9301:Postn UTSW 3 54,292,659 (GRCm39) missense probably benign 0.26
R9313:Postn UTSW 3 54,273,336 (GRCm39) missense probably damaging 0.99
R9657:Postn UTSW 3 54,290,820 (GRCm39) missense probably benign 0.04
RF018:Postn UTSW 3 54,291,913 (GRCm39) missense probably damaging 0.96
X0004:Postn UTSW 3 54,270,115 (GRCm39) missense probably damaging 1.00
X0022:Postn UTSW 3 54,278,261 (GRCm39) missense probably benign 0.03
Z1088:Postn UTSW 3 54,282,548 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GCACAGTCAAATGTTCAAGACA -3'
(R):5'- CAAACCAAATATCATTGAAACGTGT -3'

Sequencing Primer
(F):5'- TGTTCAAGACATTACAAACAAGAGAG -3'
(R):5'- CTCTTCACTGGAGAAGGCTGATTC -3'
Posted On 2015-10-21