Incidental Mutation 'R4697:Glmp'
ID 355758
Institutional Source Beutler Lab
Gene Symbol Glmp
Ensembl Gene ENSMUSG00000001418
Gene Name glycosylated lysosomal membrane protein
Synonyms 0610031J06Rik, NCU-G1
MMRRC Submission 041947-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4697 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 88232330-88235938 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88235581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 47 (V47A)
Ref Sequence ENSEMBL: ENSMUSP00000134809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001454] [ENSMUST00000001456] [ENSMUST00000107552] [ENSMUST00000107553] [ENSMUST00000131666] [ENSMUST00000154381] [ENSMUST00000176425] [ENSMUST00000177005] [ENSMUST00000193872] [ENSMUST00000176519]
AlphaFold Q9JHJ3
Predicted Effect probably damaging
Transcript: ENSMUST00000001454
AA Change: V308A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001454
Gene: ENSMUSG00000001418
AA Change: V308A

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 130 2.7e-26 PFAM
Pfam:NCU-G1 124 333 4.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001456
SMART Domains Protein: ENSMUSP00000001456
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107552
SMART Domains Protein: ENSMUSP00000103176
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107553
SMART Domains Protein: ENSMUSP00000103177
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131666
SMART Domains Protein: ENSMUSP00000120235
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153716
Predicted Effect probably damaging
Transcript: ENSMUST00000154381
AA Change: V47A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134809
Gene: ENSMUSG00000001418
AA Change: V47A

DomainStartEndE-ValueType
Pfam:NCU-G1 2 72 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176425
AA Change: V289A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135575
Gene: ENSMUSG00000001418
AA Change: V289A

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 37 314 3.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177005
AA Change: V374A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135398
Gene: ENSMUSG00000001418
AA Change: V374A

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 54 397 1.1e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193646
Predicted Effect probably benign
Transcript: ENSMUST00000193872
SMART Domains Protein: ENSMUSP00000141830
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176519
SMART Domains Protein: ENSMUSP00000135263
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 125 4.7e-26 PFAM
Meta Mutation Damage Score 0.1506 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Homozygous mutants for this allele displayed spontaneous development of liver fibrosis at 6 months and various hepatic cell phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,615,243 (GRCm39) M1T probably null Het
Aatf T A 11: 84,339,964 (GRCm39) D449V probably damaging Het
Acbd3 T A 1: 180,549,509 (GRCm39) probably benign Het
Bicc1 T A 10: 70,789,314 (GRCm39) I366F possibly damaging Het
Ccdc74a T C 16: 17,467,613 (GRCm39) S184P possibly damaging Het
Cntn4 T C 6: 106,502,446 (GRCm39) V401A probably damaging Het
Cux2 T C 5: 122,011,816 (GRCm39) T540A probably damaging Het
Disp2 G T 2: 118,622,165 (GRCm39) E966* probably null Het
Dpp7 A G 2: 25,244,931 (GRCm39) Y209H probably benign Het
Dstyk T A 1: 132,377,225 (GRCm39) F277Y probably damaging Het
Dtx1 A T 5: 120,832,473 (GRCm39) probably null Het
Ear-ps2 G A 14: 44,284,517 (GRCm39) noncoding transcript Het
Ednra T C 8: 78,391,624 (GRCm39) H422R probably benign Het
Erlec1 T A 11: 30,902,640 (GRCm39) I67F probably benign Het
Fam161b G A 12: 84,395,332 (GRCm39) probably benign Het
Gata5 A T 2: 179,969,172 (GRCm39) C345* probably null Het
Gm9762 T A 3: 78,873,857 (GRCm39) noncoding transcript Het
Gnas A T 2: 174,139,873 (GRCm39) D14V probably damaging Het
Gnl3 T C 14: 30,739,286 (GRCm39) S53G probably damaging Het
Grhl3 C T 4: 135,275,777 (GRCm39) V527M probably damaging Het
Hoxd10 T A 2: 74,524,531 (GRCm39) L281* probably null Het
Kif16b T G 2: 142,532,614 (GRCm39) Y1175S probably benign Het
Kif2b A G 11: 91,467,672 (GRCm39) S204P probably benign Het
Klhl40 T A 9: 121,607,800 (GRCm39) I320N probably damaging Het
Ksr2 G A 5: 117,846,212 (GRCm39) R693Q probably damaging Het
Mis12 A G 11: 70,916,152 (GRCm39) K62E possibly damaging Het
Mlc1 A G 15: 88,858,980 (GRCm39) C102R probably damaging Het
Muc5b T C 7: 141,411,098 (GRCm39) I1348T unknown Het
Myh7b A G 2: 155,471,242 (GRCm39) E1130G probably damaging Het
Nat8f4 T C 6: 85,878,368 (GRCm39) T52A probably benign Het
Nxpe2 C A 9: 48,231,821 (GRCm39) V379L probably benign Het
Or10ad1c G A 15: 98,084,749 (GRCm39) R310W probably damaging Het
Or4c1 T A 2: 89,133,247 (GRCm39) S230C probably damaging Het
Or4c1 C A 2: 89,133,246 (GRCm39) S230I possibly damaging Het
Or5b111 A T 19: 13,291,081 (GRCm39) D189E probably benign Het
Or5b12 C T 19: 12,897,298 (GRCm39) C125Y probably damaging Het
Pcdhga7 A T 18: 37,850,261 (GRCm39) Y756F probably damaging Het
Pcsk6 T A 7: 65,608,989 (GRCm39) Y284N probably damaging Het
Pdcd11 T C 19: 47,114,786 (GRCm39) V1367A possibly damaging Het
Postn T A 3: 54,282,492 (GRCm39) N484K probably damaging Het
Prkd3 C T 17: 79,268,600 (GRCm39) V572I probably benign Het
Qser1 T C 2: 104,617,528 (GRCm39) S1005G probably benign Het
Radil G T 5: 142,472,556 (GRCm39) D951E probably benign Het
Ripk1 C T 13: 34,211,925 (GRCm39) R352* probably null Het
Sacs T C 14: 61,450,196 (GRCm39) F4081L probably benign Het
Sbf1 A G 15: 89,199,288 (GRCm39) V11A possibly damaging Het
Sgip1 T A 4: 102,791,784 (GRCm39) F536I probably damaging Het
Slc45a1 A G 4: 150,722,741 (GRCm39) L381P probably damaging Het
Smarcad1 C T 6: 65,029,625 (GRCm39) P71L probably benign Het
Spns1 T A 7: 125,976,209 (GRCm39) D14V probably damaging Het
Sv2c T A 13: 96,122,526 (GRCm39) I417F possibly damaging Het
Tas2r113 T A 6: 132,870,479 (GRCm39) M169K probably benign Het
Tgm1 A T 14: 55,943,138 (GRCm39) N567K probably benign Het
Thoc2l A G 5: 104,670,106 (GRCm39) K1543E probably benign Het
Tln2 C T 9: 67,302,743 (GRCm39) R76Q probably damaging Het
Trpm6 T C 19: 18,831,155 (GRCm39) V1340A probably benign Het
Tspan18 A T 2: 93,142,375 (GRCm39) probably null Het
Txndc11 C T 16: 10,902,178 (GRCm39) V679I probably damaging Het
Usf1 G T 1: 171,244,532 (GRCm39) G144V possibly damaging Het
Vmn1r59 T C 7: 5,457,451 (GRCm39) Y103C probably damaging Het
Vmn2r23 A T 6: 123,718,785 (GRCm39) I713F probably damaging Het
Vmn2r79 A T 7: 86,687,168 (GRCm39) I850F probably damaging Het
Vps35l T A 7: 118,390,671 (GRCm39) I455N probably damaging Het
Wdr90 C T 17: 26,074,337 (GRCm39) R676H probably benign Het
Zfp867 G A 11: 59,354,487 (GRCm39) R281W probably damaging Het
Zfp939 T C 7: 39,122,366 (GRCm39) noncoding transcript Het
Other mutations in Glmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Glmp APN 3 88,233,169 (GRCm39) splice site probably null
IGL02551:Glmp APN 3 88,232,389 (GRCm39) start codon destroyed probably null 0.53
IGL03212:Glmp APN 3 88,235,664 (GRCm39) missense probably benign 0.01
R0325:Glmp UTSW 3 88,232,391 (GRCm39) start codon destroyed probably null 0.72
R0719:Glmp UTSW 3 88,233,452 (GRCm39) nonsense probably null
R0721:Glmp UTSW 3 88,233,452 (GRCm39) nonsense probably null
R1617:Glmp UTSW 3 88,235,426 (GRCm39) splice site probably benign
R1970:Glmp UTSW 3 88,235,177 (GRCm39) missense probably damaging 1.00
R3824:Glmp UTSW 3 88,233,718 (GRCm39) missense probably damaging 1.00
R3825:Glmp UTSW 3 88,233,718 (GRCm39) missense probably damaging 1.00
R4521:Glmp UTSW 3 88,235,346 (GRCm39) missense possibly damaging 0.60
R4806:Glmp UTSW 3 88,233,320 (GRCm39) intron probably benign
R4823:Glmp UTSW 3 88,232,530 (GRCm39) intron probably benign
R5035:Glmp UTSW 3 88,233,951 (GRCm39) splice site probably benign
R5043:Glmp UTSW 3 88,233,983 (GRCm39) intron probably benign
R5335:Glmp UTSW 3 88,233,962 (GRCm39) intron probably benign
R5592:Glmp UTSW 3 88,233,333 (GRCm39) intron probably benign
R5738:Glmp UTSW 3 88,233,445 (GRCm39) missense probably benign 0.06
R5921:Glmp UTSW 3 88,233,283 (GRCm39) missense probably benign 0.09
R6046:Glmp UTSW 3 88,232,495 (GRCm39) missense probably damaging 0.96
R6103:Glmp UTSW 3 88,235,338 (GRCm39) missense probably benign 0.02
R6859:Glmp UTSW 3 88,235,349 (GRCm39) missense probably benign 0.30
R6943:Glmp UTSW 3 88,233,917 (GRCm39) missense probably damaging 1.00
R6945:Glmp UTSW 3 88,233,139 (GRCm39) missense probably benign 0.02
R7204:Glmp UTSW 3 88,233,917 (GRCm39) missense probably damaging 1.00
R7770:Glmp UTSW 3 88,233,077 (GRCm39) missense probably benign 0.39
R8022:Glmp UTSW 3 88,233,827 (GRCm39) missense probably damaging 1.00
R8079:Glmp UTSW 3 88,233,045 (GRCm39) missense probably damaging 0.98
R8296:Glmp UTSW 3 88,233,580 (GRCm39) missense probably benign 0.16
R8986:Glmp UTSW 3 88,233,002 (GRCm39) missense probably benign 0.28
R9266:Glmp UTSW 3 88,233,036 (GRCm39) missense probably damaging 0.98
R9335:Glmp UTSW 3 88,235,563 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAATCTGACCTTTGGGGC -3'
(R):5'- CTGAGGTTCTGCAGAAAAGC -3'

Sequencing Primer
(F):5'- GGGACCAATACTACCTTTGCTGG -3'
(R):5'- AAGCAGATCATGACCCTGGGC -3'
Posted On 2015-10-21