Incidental Mutation 'R4697:Sgip1'
ID355759
Institutional Source Beutler Lab
Gene Symbol Sgip1
Ensembl Gene ENSMUSG00000028524
Gene NameSH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms3110007P09Rik
MMRRC Submission 041947-MU
Accession Numbers

Genbank: NM_144906; MGI: 1920344

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4697 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location102741297-102973628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102934587 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 536 (F536I)
Ref Sequence ENSEMBL: ENSMUSP00000102495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066824] [ENSMUST00000072481] [ENSMUST00000080728] [ENSMUST00000106882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066824
AA Change: F369I

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063712
Gene: ENSMUSG00000028524
AA Change: F369I

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 391 658 5.9e-79 PFAM
Pfam:Adap_comp_sub 469 650 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072481
SMART Domains Protein: ENSMUSP00000072301
Gene: ENSMUSG00000028524

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 371 638 5.5e-79 PFAM
Pfam:Adap_comp_sub 449 630 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080728
SMART Domains Protein: ENSMUSP00000079553
Gene: ENSMUSG00000028524

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 538 805 9e-79 PFAM
Pfam:Adap_comp_sub 617 797 2.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106882
AA Change: F536I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102495
Gene: ENSMUSG00000028524
AA Change: F536I

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 558 825 1.7e-74 PFAM
Pfam:Adap_comp_sub 657 809 1.2e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149547
AA Change: F284I
SMART Domains Protein: ENSMUSP00000122556
Gene: ENSMUSG00000028524
AA Change: F284I

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 175 202 N/A INTRINSIC
low complexity region 207 224 N/A INTRINSIC
low complexity region 226 247 N/A INTRINSIC
Pfam:muHD 307 574 3.9e-75 PFAM
Pfam:Adap_comp_sub 404 558 3.2e-10 PFAM
Meta Mutation Damage Score 0.2212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SGIP1 functions as an endocytic protein that affects signaling by receptors in neuronal systems involved in energy homeostasis via its interaction with endophilins (see SH3GL3; MIM 603362) (Trevaskis et al., 2005 [PubMed 15919751] and Uezu et al., 2007 [PubMed 17626015]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Sgip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Sgip1 APN 4 102928921 splice site probably benign
IGL01348:Sgip1 APN 4 102915156 splice site probably null
IGL01446:Sgip1 APN 4 102928913 critical splice donor site probably null
IGL01937:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL01945:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL02249:Sgip1 APN 4 102911470 missense probably benign 0.40
IGL03232:Sgip1 APN 4 102915054 splice site probably benign
3-1:Sgip1 UTSW 4 102967663 missense probably damaging 1.00
PIT4378001:Sgip1 UTSW 4 102921083 missense unknown
R0309:Sgip1 UTSW 4 102915157 splice site probably benign
R0689:Sgip1 UTSW 4 102966252 missense probably damaging 1.00
R1563:Sgip1 UTSW 4 102966260 missense probably benign 0.38
R1715:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R1899:Sgip1 UTSW 4 102968337 critical splice donor site probably null
R2286:Sgip1 UTSW 4 102867647 missense possibly damaging 0.95
R2372:Sgip1 UTSW 4 102909791 critical splice donor site probably null
R3836:Sgip1 UTSW 4 102867700 splice site probably null
R4670:Sgip1 UTSW 4 102869754 missense probably damaging 1.00
R4725:Sgip1 UTSW 4 102966222 missense probably damaging 1.00
R4892:Sgip1 UTSW 4 102966234 missense probably damaging 1.00
R5112:Sgip1 UTSW 4 102869769 missense probably damaging 1.00
R5236:Sgip1 UTSW 4 102927587 critical splice donor site probably null
R5285:Sgip1 UTSW 4 102921477 unclassified probably benign
R5323:Sgip1 UTSW 4 102966280 missense probably damaging 1.00
R5384:Sgip1 UTSW 4 102934566 missense possibly damaging 0.46
R5386:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R5682:Sgip1 UTSW 4 102967650 missense possibly damaging 0.88
R6226:Sgip1 UTSW 4 102966195 missense probably damaging 1.00
R6371:Sgip1 UTSW 4 102966285 missense probably damaging 1.00
R6594:Sgip1 UTSW 4 102962479 missense probably damaging 0.98
R6656:Sgip1 UTSW 4 102905568 intron probably benign
R6800:Sgip1 UTSW 4 102921028 unclassified probably benign
R6855:Sgip1 UTSW 4 102962376 missense probably damaging 0.99
R6917:Sgip1 UTSW 4 102968191 missense probably damaging 1.00
R7340:Sgip1 UTSW 4 102921464 missense unknown
R7414:Sgip1 UTSW 4 102967624 nonsense probably null
R7612:Sgip1 UTSW 4 102869808 missense probably benign 0.28
R7936:Sgip1 UTSW 4 102928900 missense possibly damaging 0.66
R7944:Sgip1 UTSW 4 102915101 missense probably benign
R7976:Sgip1 UTSW 4 102900539 critical splice donor site probably null
R8508:Sgip1 UTSW 4 102915071 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTTTCCTGCACGCTAACGGC -3'
(R):5'- TGAGGTCAACTGCAAATCAGC -3'

Sequencing Primer
(F):5'- ACGCTAACGGCATGCAGTG -3'
(R):5'- CATGAAATGCCTTCTTTAGTTCTTG -3'
Posted On2015-10-21