Mutagenetix > Incidental Mutation

Incidental Mutation 'R4697:Cux2'

355765

Institutional Source

Beutler Lab

Gene Symbol

Cux2

Ensembl Gene

ENSMUSG00000042589

Gene Name

cut-like homeobox 2

Synonyms

Cutl2, Cux-2, ENSMUSG00000072641, 1700051K22Rik, Cux2

MMRRC Submission

041947-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.572) question?

Stock #

R4697 (G1)

Quality Score

205

Status

Validated

Chromosome

Chromosomal Location

121856366-122050102 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121873753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 540 (T540A)

Ref Sequence

ENSEMBL: ENSMUSP00000130302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086317] [ENSMUST00000111752] [ENSMUST00000168288]

AlphaFold

P70298

Predicted Effect

probably damaging
Transcript: ENSMUST00000086317
AA Change: T540A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000083497
Gene: ENSMUSG00000042589
AA Change: T540A

Domain	Start	End	E-Value	Type
coiled coil region	133	214	N/A	INTRINSIC
coiled coil region	235	311	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
CUT	484	569	7.62e-34	SMART
coiled coil region	626	655	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	740	757	N/A	INTRINSIC
CUT	829	917	6.52e-42	SMART
low complexity region	965	976	N/A	INTRINSIC
CUT	984	1070	1.12e-40	SMART
HOX	1113	1175	7.54e-13	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111752
AA Change: T540A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107381
Gene: ENSMUSG00000042589
AA Change: T540A

Domain	Start	End	E-Value	Type
coiled coil region	133	214	N/A	INTRINSIC
coiled coil region	235	311	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
CUT	484	569	7.62e-34	SMART
coiled coil region	626	655	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	740	757	N/A	INTRINSIC
CUT	829	917	6.52e-42	SMART
low complexity region	965	976	N/A	INTRINSIC
CUT	984	1070	1.12e-40	SMART
HOX	1113	1175	7.54e-13	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156942

SMART Domains

Protein: ENSMUSP00000114239
Gene: ENSMUSG00000042589

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
CUT	50	135	7.62e-34	SMART
low complexity region	152	162	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168288
AA Change: T540A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130302
Gene: ENSMUSG00000042589
AA Change: T540A

Domain	Start	End	E-Value	Type
coiled coil region	133	214	N/A	INTRINSIC
coiled coil region	235	311	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
CUT	484	569	7.62e-34	SMART
coiled coil region	626	655	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	740	757	N/A	INTRINSIC
CUT	829	917	6.52e-42	SMART
low complexity region	965	976	N/A	INTRINSIC
CUT	984	1070	1.12e-40	SMART
HOX	1113	1175	7.54e-13	SMART
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC

Meta Mutation Damage Score

0.3211

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: This gene is a member of the Cut family of transcription factors that have multiple DNA binding domains and regulate cell proliferation and differentiation. This gene is primarily expressed in nervous tissues where it controls the proliferation of neuronal precursors, and may play a role in organogenesis earlier during embryonic development. Mice lacking the encoded protein exhibit smaller spinal cords with deficits in neural progenitor development as well as in neuroblast and interneuron differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various neural defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,791,448	I455N	probably damaging	Het
A2m	T	C	6: 121,638,284	M1T	probably null	Het
Aatf	T	A	11: 84,449,138	D449V	probably damaging	Het
Acbd3	T	A	1: 180,721,944		probably benign	Het
BC005561	A	G	5: 104,522,240	K1543E	probably benign	Het
Bicc1	T	A	10: 70,953,484	I366F	possibly damaging	Het
Ccdc74a	T	C	16: 17,649,749	S184P	possibly damaging	Het
Cntn4	T	C	6: 106,525,485	V401A	probably damaging	Het
Disp2	G	T	2: 118,791,684	E966*	probably null	Het
Dpp7	A	G	2: 25,354,919	Y209H	probably benign	Het
Dstyk	T	A	1: 132,449,487	F277Y	probably damaging	Het
Dtx1	A	T	5: 120,694,408		probably null	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Ednra	T	C	8: 77,664,995	H422R	probably benign	Het
Erlec1	T	A	11: 30,952,640	I67F	probably benign	Het
Fam161b	G	A	12: 84,348,558		probably benign	Het
Gata5	A	T	2: 180,327,379	C345*	probably null	Het
Glmp	T	C	3: 88,328,274	V47A	probably damaging	Het
Gm9762	T	A	3: 78,966,550		noncoding transcript	Het
Gnas	A	T	2: 174,298,080	D14V	probably damaging	Het
Gnl3	T	C	14: 31,017,329	S53G	probably damaging	Het
Grhl3	C	T	4: 135,548,466	V527M	probably damaging	Het
Hoxd10	T	A	2: 74,694,187	L281*	probably null	Het
Kif16b	T	G	2: 142,690,694	Y1175S	probably benign	Het
Kif2b	A	G	11: 91,576,846	S204P	probably benign	Het
Klhl40	T	A	9: 121,778,734	I320N	probably damaging	Het
Ksr2	G	A	5: 117,708,147	R693Q	probably damaging	Het
Mis12	A	G	11: 71,025,326	K62E	possibly damaging	Het
Mlc1	A	G	15: 88,974,777	C102R	probably damaging	Het
Muc5b	T	C	7: 141,857,361	I1348T	unknown	Het
Myh7b	A	G	2: 155,629,322	E1130G	probably damaging	Het
Nat8f4	T	C	6: 85,901,386	T52A	probably benign	Het
Nxpe2	C	A	9: 48,320,521	V379L	probably benign	Het
Olfr1231	C	A	2: 89,302,902	S230I	possibly damaging	Het
Olfr1231	T	A	2: 89,302,903	S230C	probably damaging	Het
Olfr1448	C	T	19: 12,919,934	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,313,717	D189E	probably benign	Het
Olfr288	G	A	15: 98,186,868	R310W	probably damaging	Het
Pcdhga7	A	T	18: 37,717,208	Y756F	probably damaging	Het
Pcsk6	T	A	7: 65,959,241	Y284N	probably damaging	Het
Pdcd11	T	C	19: 47,126,347	V1367A	possibly damaging	Het
Postn	T	A	3: 54,375,071	N484K	probably damaging	Het
Prkd3	C	T	17: 78,961,171	V572I	probably benign	Het
Qser1	T	C	2: 104,787,183	S1005G	probably benign	Het
Radil	G	T	5: 142,486,801	D951E	probably benign	Het
Ripk1	C	T	13: 34,027,942	R352*	probably null	Het
Sacs	T	C	14: 61,212,747	F4081L	probably benign	Het
Sbf1	A	G	15: 89,315,085	V11A	possibly damaging	Het
Sgip1	T	A	4: 102,934,587	F536I	probably damaging	Het
Slc45a1	A	G	4: 150,638,284	L381P	probably damaging	Het
Smarcad1	C	T	6: 65,052,641	P71L	probably benign	Het
Spns1	T	A	7: 126,377,037	D14V	probably damaging	Het
Sv2c	T	A	13: 95,986,018	I417F	possibly damaging	Het
Tas2r113	T	A	6: 132,893,516	M169K	probably benign	Het
Tgm1	A	T	14: 55,705,681	N567K	probably benign	Het
Tln2	C	T	9: 67,395,461	R76Q	probably damaging	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Tspan18	A	T	2: 93,312,030		probably null	Het
Txndc11	C	T	16: 11,084,314	V679I	probably damaging	Het
Usf1	G	T	1: 171,416,964	G144V	possibly damaging	Het
Vmn1r59	T	C	7: 5,454,452	Y103C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,826	I713F	probably damaging	Het
Vmn2r79	A	T	7: 87,037,960	I850F	probably damaging	Het
Wdr90	C	T	17: 25,855,363	R676H	probably benign	Het
Zfp867	G	A	11: 59,463,661	R281W	probably damaging	Het
Zfp939	T	C	7: 39,472,942		noncoding transcript	Het

Other mutations in Cux2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Cux2	APN	5	121868538	missense	possibly damaging	0.92
IGL00917:Cux2	APN	5	121869105	missense	probably null	0.05
IGL00979:Cux2	APN	5	121873714	missense	probably damaging	0.98
IGL01069:Cux2	APN	5	121867351	missense	possibly damaging	0.84
IGL01303:Cux2	APN	5	121865928	missense	probably benign	0.03
IGL01583:Cux2	APN	5	121874107	missense	probably damaging	0.98
IGL01762:Cux2	APN	5	121873145	missense	probably damaging	1.00
IGL02508:Cux2	APN	5	121860822	missense	possibly damaging	0.93
R0333:Cux2	UTSW	5	121860608	missense	probably benign	0.04
R0352:Cux2	UTSW	5	121884739	splice site	probably benign
R0443:Cux2	UTSW	5	121887437	missense	possibly damaging	0.66
R1853:Cux2	UTSW	5	121869121	missense	possibly damaging	0.95
R2011:Cux2	UTSW	5	121861326	missense	probably benign	0.21
R2057:Cux2	UTSW	5	121869504	missense	probably benign	0.02
R2165:Cux2	UTSW	5	121887477	missense	possibly damaging	0.78
R3964:Cux2	UTSW	5	121887476	nonsense	probably null
R4182:Cux2	UTSW	5	121868492	missense	probably damaging	1.00
R4579:Cux2	UTSW	5	121860653	missense	probably benign	0.01
R4655:Cux2	UTSW	5	121885934	missense	possibly damaging	0.95
R4673:Cux2	UTSW	5	121887476	nonsense	probably null
R4927:Cux2	UTSW	5	121877089	missense	probably benign	0.13
R5348:Cux2	UTSW	5	121865978	missense	probably damaging	0.99
R6208:Cux2	UTSW	5	121860822	missense	possibly damaging	0.93
R6500:Cux2	UTSW	5	121864726	missense	probably benign	0.03
R6661:Cux2	UTSW	5	121869297	missense	probably benign	0.04
R6986:Cux2	UTSW	5	121868579	missense	possibly damaging	0.84
R7296:Cux2	UTSW	5	121861256	missense	probably benign	0.25
R7561:Cux2	UTSW	5	121879868	missense	probably benign	0.31
R7702:Cux2	UTSW	5	121868585	missense	possibly damaging	0.70
R7705:Cux2	UTSW	5	121869673	missense	probably benign	0.13
R7791:Cux2	UTSW	5	121867099	missense	probably benign	0.10
R7998:Cux2	UTSW	5	121868585	missense	possibly damaging	0.70
R8081:Cux2	UTSW	5	121869456	missense	probably benign	0.13
R8096:Cux2	UTSW	5	121869097	missense	possibly damaging	0.70
R8191:Cux2	UTSW	5	121874154	missense	probably benign	0.31
R8794:Cux2	UTSW	5	121869243	missense	probably benign	0.31
R8957:Cux2	UTSW	5	121860948	missense	probably benign	0.36
R9601:Cux2	UTSW	5	121887398	missense	possibly damaging	0.85
R9749:Cux2	UTSW	5	121869717	missense	possibly damaging	0.95
R9765:Cux2	UTSW	5	121869132	missense	probably benign	0.00
X0027:Cux2	UTSW	5	121884751	missense	probably benign	0.13
Z1176:Cux2	UTSW	5	121873813	nonsense	probably null
Z1176:Cux2	UTSW	5	121885934	missense	probably benign	0.02
Z1177:Cux2	UTSW	5	121873680	missense	probably damaging	1.00
Z1177:Cux2	UTSW	5	121877129	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- GAGTCTGTCCCTCGAAATAGG -3'
(R):5'- CCAAACATATGATGGGCCCAG -3'

Sequencing Primer
(F):5'- GGAAACCAAGGCACAGGGTG -3'
(R):5'- ACTTTCTACGGTGGTGCCAAG -3'

Posted On

2015-10-21