Mutagenetix > Incidental Mutations

Incidental Mutation 'R4697:A2m'

355771

Institutional Source

Beutler Lab

Gene Symbol

A2m

Ensembl Gene

ENSMUSG00000030111

Gene Name

alpha-2-macroglobulin

Synonyms

A2mp

MMRRC Submission

041947-MU

Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121635376-121679227 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to C at 121638284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1 (M1T)

Ref Sequence

ENSEMBL: ENSMUSP00000144862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032203] [ENSMUST00000204850]

AlphaFold

Q6GQT1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032203
AA Change: M39T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: M39T

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:A2M_N	134	227	2.1e-20	PFAM
low complexity region	334	347	N/A	INTRINSIC
A2M_N_2	465	613	2.04e-31	SMART
low complexity region	722	731	N/A	INTRINSIC
A2M	738	828	2.31e-39	SMART
Pfam:Thiol-ester_cl	961	990	4.4e-18	PFAM
Pfam:A2M_comp	1010	1266	1.4e-98	PFAM
A2M_recep	1376	1463	2.69e-40	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000204850
AA Change: M1T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.4639

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,791,448	I455N	probably damaging	Het
Aatf	T	A	11: 84,449,138	D449V	probably damaging	Het
Acbd3	T	A	1: 180,721,944		probably benign	Het
BC005561	A	G	5: 104,522,240	K1543E	probably benign	Het
Bicc1	T	A	10: 70,953,484	I366F	possibly damaging	Het
Ccdc74a	T	C	16: 17,649,749	S184P	possibly damaging	Het
Cntn4	T	C	6: 106,525,485	V401A	probably damaging	Het
Cux2	T	C	5: 121,873,753	T540A	probably damaging	Het
Disp2	G	T	2: 118,791,684	E966*	probably null	Het
Dpp7	A	G	2: 25,354,919	Y209H	probably benign	Het
Dstyk	T	A	1: 132,449,487	F277Y	probably damaging	Het
Dtx1	A	T	5: 120,694,408		probably null	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Ednra	T	C	8: 77,664,995	H422R	probably benign	Het
Erlec1	T	A	11: 30,952,640	I67F	probably benign	Het
Fam161b	G	A	12: 84,348,558		probably benign	Het
Gata5	A	T	2: 180,327,379	C345*	probably null	Het
Glmp	T	C	3: 88,328,274	V47A	probably damaging	Het
Gm9762	T	A	3: 78,966,550		noncoding transcript	Het
Gnas	A	T	2: 174,298,080	D14V	probably damaging	Het
Gnl3	T	C	14: 31,017,329	S53G	probably damaging	Het
Grhl3	C	T	4: 135,548,466	V527M	probably damaging	Het
Hoxd10	T	A	2: 74,694,187	L281*	probably null	Het
Kif16b	T	G	2: 142,690,694	Y1175S	probably benign	Het
Kif2b	A	G	11: 91,576,846	S204P	probably benign	Het
Klhl40	T	A	9: 121,778,734	I320N	probably damaging	Het
Ksr2	G	A	5: 117,708,147	R693Q	probably damaging	Het
Mis12	A	G	11: 71,025,326	K62E	possibly damaging	Het
Mlc1	A	G	15: 88,974,777	C102R	probably damaging	Het
Muc5b	T	C	7: 141,857,361	I1348T	unknown	Het
Myh7b	A	G	2: 155,629,322	E1130G	probably damaging	Het
Nat8f4	T	C	6: 85,901,386	T52A	probably benign	Het
Nxpe2	C	A	9: 48,320,521	V379L	probably benign	Het
Olfr1231	C	A	2: 89,302,902	S230I	possibly damaging	Het
Olfr1231	T	A	2: 89,302,903	S230C	probably damaging	Het
Olfr1448	C	T	19: 12,919,934	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,313,717	D189E	probably benign	Het
Olfr288	G	A	15: 98,186,868	R310W	probably damaging	Het
Pcdhga7	A	T	18: 37,717,208	Y756F	probably damaging	Het
Pcsk6	T	A	7: 65,959,241	Y284N	probably damaging	Het
Pdcd11	T	C	19: 47,126,347	V1367A	possibly damaging	Het
Postn	T	A	3: 54,375,071	N484K	probably damaging	Het
Prkd3	C	T	17: 78,961,171	V572I	probably benign	Het
Qser1	T	C	2: 104,787,183	S1005G	probably benign	Het
Radil	G	T	5: 142,486,801	D951E	probably benign	Het
Ripk1	C	T	13: 34,027,942	R352*	probably null	Het
Sacs	T	C	14: 61,212,747	F4081L	probably benign	Het
Sbf1	A	G	15: 89,315,085	V11A	possibly damaging	Het
Sgip1	T	A	4: 102,934,587	F536I	probably damaging	Het
Slc45a1	A	G	4: 150,638,284	L381P	probably damaging	Het
Smarcad1	C	T	6: 65,052,641	P71L	probably benign	Het
Spns1	T	A	7: 126,377,037	D14V	probably damaging	Het
Sv2c	T	A	13: 95,986,018	I417F	possibly damaging	Het
Tas2r113	T	A	6: 132,893,516	M169K	probably benign	Het
Tgm1	A	T	14: 55,705,681	N567K	probably benign	Het
Tln2	C	T	9: 67,395,461	R76Q	probably damaging	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Tspan18	A	T	2: 93,312,030		probably null	Het
Txndc11	C	T	16: 11,084,314	V679I	probably damaging	Het
Usf1	G	T	1: 171,416,964	G144V	possibly damaging	Het
Vmn1r59	T	C	7: 5,454,452	Y103C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,826	I713F	probably damaging	Het
Vmn2r79	A	T	7: 87,037,960	I850F	probably damaging	Het
Wdr90	C	T	17: 25,855,363	R676H	probably benign	Het
Zfp867	G	A	11: 59,463,661	R281W	probably damaging	Het
Zfp939	T	C	7: 39,472,942		noncoding transcript	Het

Other mutations in A2m

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:A2m	APN	6	121644149	missense	possibly damaging	0.67
IGL00798:A2m	APN	6	121671010	missense	probably damaging	1.00
IGL01154:A2m	APN	6	121673542	nonsense	probably null
IGL01313:A2m	APN	6	121645010	critical splice donor site	probably null
IGL01337:A2m	APN	6	121668570	missense	probably damaging	0.98
IGL01505:A2m	APN	6	121676947	missense	possibly damaging	0.83
IGL01508:A2m	APN	6	121659367	nonsense	probably null
IGL01672:A2m	APN	6	121641357	missense	probably damaging	1.00
IGL01951:A2m	APN	6	121667190	missense	possibly damaging	0.78
IGL02012:A2m	APN	6	121674861	missense	probably damaging	1.00
IGL02066:A2m	APN	6	121649895	missense	probably damaging	1.00
IGL02234:A2m	APN	6	121668220	missense	possibly damaging	0.67
IGL02397:A2m	APN	6	121646875	missense	probably benign
IGL02407:A2m	APN	6	121668616	nonsense	probably null
IGL02408:A2m	APN	6	121644171	missense	probably damaging	0.99
IGL02469:A2m	APN	6	121668115	missense	probably damaging	1.00
IGL02527:A2m	APN	6	121661433	missense	probably damaging	0.99
IGL02612:A2m	APN	6	121678012	missense	probably benign
IGL02746:A2m	APN	6	121669503	splice site	probably benign
IGL02952:A2m	APN	6	121678025	missense	probably damaging	0.99
IGL03056:A2m	APN	6	121670903	missense	probably damaging	0.96
IGL03121:A2m	APN	6	121641306	missense	probably benign	0.02
IGL03303:A2m	APN	6	121667163	missense	probably damaging	1.00
IGL03369:A2m	APN	6	121676903	critical splice acceptor site	probably null
IGL03046:A2m	UTSW	6	121659323	missense	probably benign	0.04
R0040:A2m	UTSW	6	121645206	missense	possibly damaging	0.93
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0109:A2m	UTSW	6	121659303	missense	probably benign	0.00
R0147:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0148:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0345:A2m	UTSW	6	121638272	splice site	probably benign
R0445:A2m	UTSW	6	121657955	missense	probably damaging	1.00
R0766:A2m	UTSW	6	121676890	splice site	probably benign
R1186:A2m	UTSW	6	121661534	missense	probably benign	0.00
R1436:A2m	UTSW	6	121644213	missense	probably benign	0.09
R1452:A2m	UTSW	6	121678056	missense	probably benign	0.01
R1636:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1637:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1638:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1698:A2m	UTSW	6	121645158	missense	possibly damaging	0.88
R1776:A2m	UTSW	6	121641424	missense	probably damaging	1.00
R1791:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1918:A2m	UTSW	6	121644936	missense	probably benign	0.16
R1921:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1927:A2m	UTSW	6	121636379	missense	probably damaging	1.00
R1934:A2m	UTSW	6	121649833	missense	probably damaging	0.98
R1943:A2m	UTSW	6	121668547	missense	possibly damaging	0.90
R1996:A2m	UTSW	6	121669597	missense	probably damaging	1.00
R2039:A2m	UTSW	6	121659949	missense	probably benign	0.32
R2085:A2m	UTSW	6	121676959	missense	probably damaging	1.00
R2092:A2m	UTSW	6	121674937	nonsense	probably null
R2105:A2m	UTSW	6	121673500	missense	probably benign	0.04
R2107:A2m	UTSW	6	121654612	missense	probably benign	0.04
R2235:A2m	UTSW	6	121642064	missense	probably benign	0.21
R2292:A2m	UTSW	6	121673559	missense	possibly damaging	0.90
R2350:A2m	UTSW	6	121678088	splice site	probably benign
R3001:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3002:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3023:A2m	UTSW	6	121669572	missense	probably benign	0.08
R3429:A2m	UTSW	6	121636290	start codon destroyed	probably null
R3437:A2m	UTSW	6	121639294	missense	probably null	0.03
R3909:A2m	UTSW	6	121648166	missense	probably damaging	1.00
R4300:A2m	UTSW	6	121673475	missense	probably benign	0.00
R4332:A2m	UTSW	6	121657447	missense	probably benign	0.01
R4584:A2m	UTSW	6	121657406	missense	probably benign	0.07
R4710:A2m	UTSW	6	121641303	missense	probably benign	0.03
R4841:A2m	UTSW	6	121646844	missense	probably benign	0.06
R5206:A2m	UTSW	6	121674807	missense	probably damaging	1.00
R5219:A2m	UTSW	6	121676950	missense	possibly damaging	0.90
R5230:A2m	UTSW	6	121674861	missense	probably damaging	1.00
R5330:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5331:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5377:A2m	UTSW	6	121645253	missense	probably benign
R5590:A2m	UTSW	6	121676932	missense	probably damaging	1.00
R5835:A2m	UTSW	6	121639336	missense	probably damaging	1.00
R5910:A2m	UTSW	6	121668117	missense	probably damaging	1.00
R5915:A2m	UTSW	6	121667163	missense	probably damaging	1.00
R5949:A2m	UTSW	6	121678073	missense	probably damaging	1.00
R5994:A2m	UTSW	6	121670903	missense	probably benign	0.38
R5996:A2m	UTSW	6	121659394	missense	probably damaging	1.00
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6090:A2m	UTSW	6	121648013	missense	probably benign	0.45
R6241:A2m	UTSW	6	121646829	missense	probably benign	0.09
R6294:A2m	UTSW	6	121654481	missense	probably benign
R6492:A2m	UTSW	6	121654505	missense	probably benign	0.35
R6554:A2m	UTSW	6	121641287	missense	probably damaging	1.00
R6597:A2m	UTSW	6	121648121	missense	probably damaging	1.00
R6742:A2m	UTSW	6	121678036	missense	probably benign	0.01
R6795:A2m	UTSW	6	121648322	splice site	probably null
R6843:A2m	UTSW	6	121638401	missense	probably benign	0.01
R7013:A2m	UTSW	6	121641386	missense	probably null	0.00
R7137:A2m	UTSW	6	121677985	missense	possibly damaging	0.85
R7167:A2m	UTSW	6	121647971	missense	probably benign
R7294:A2m	UTSW	6	121673582	nonsense	probably null
R7452:A2m	UTSW	6	121641332	missense	probably damaging	1.00
R7507:A2m	UTSW	6	121675218	missense	probably benign	0.01
R7602:A2m	UTSW	6	121642007	missense	probably damaging	1.00
R7602:A2m	UTSW	6	121670936	missense	possibly damaging	0.79
R7709:A2m	UTSW	6	121660104	missense	possibly damaging	0.81
R7766:A2m	UTSW	6	121638341	missense	probably benign	0.08
R7921:A2m	UTSW	6	121677995	missense	probably benign	0.00
R8007:A2m	UTSW	6	121670886	intron	probably benign
R8291:A2m	UTSW	6	121678058	missense	probably damaging	1.00
R8542:A2m	UTSW	6	121657410	missense	probably benign	0.03
R8856:A2m	UTSW	6	121641390	missense	probably benign	0.00
R9023:A2m	UTSW	6	121659958	missense	possibly damaging	0.90
R9154:A2m	UTSW	6	121668553	missense	probably damaging	1.00
R9156:A2m	UTSW	6	121670998	missense	probably damaging	0.98
R9255:A2m	UTSW	6	121649836	missense	probably damaging	1.00
R9269:A2m	UTSW	6	121660906	missense	probably benign	0.38
R9325:A2m	UTSW	6	121669619	missense	possibly damaging	0.81
R9393:A2m	UTSW	6	121639311	missense	possibly damaging	0.91
X0057:A2m	UTSW	6	121668176	missense	probably damaging	1.00
X0060:A2m	UTSW	6	121676080	missense	probably damaging	1.00
X0063:A2m	UTSW	6	121646876	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCTTGCTGAATACATGTGC -3'
(R):5'- TGACTCACGATGAAGGAGGC -3'

Sequencing Primer
(F):5'- CCCCTCAACAAAGATGATCACTGG -3'
(R):5'- TCACGATGAAGGAGGCACAGTG -3'

Posted On

2015-10-21