Incidental Mutation 'R4697:Vmn2r23'
ID 355772
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 041947-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R4697 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123718785 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 713 (I713F)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158091
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: I713F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: I713F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,615,243 (GRCm39) M1T probably null Het
Aatf T A 11: 84,339,964 (GRCm39) D449V probably damaging Het
Acbd3 T A 1: 180,549,509 (GRCm39) probably benign Het
Bicc1 T A 10: 70,789,314 (GRCm39) I366F possibly damaging Het
Ccdc74a T C 16: 17,467,613 (GRCm39) S184P possibly damaging Het
Cntn4 T C 6: 106,502,446 (GRCm39) V401A probably damaging Het
Cux2 T C 5: 122,011,816 (GRCm39) T540A probably damaging Het
Disp2 G T 2: 118,622,165 (GRCm39) E966* probably null Het
Dpp7 A G 2: 25,244,931 (GRCm39) Y209H probably benign Het
Dstyk T A 1: 132,377,225 (GRCm39) F277Y probably damaging Het
Dtx1 A T 5: 120,832,473 (GRCm39) probably null Het
Ear-ps2 G A 14: 44,284,517 (GRCm39) noncoding transcript Het
Ednra T C 8: 78,391,624 (GRCm39) H422R probably benign Het
Erlec1 T A 11: 30,902,640 (GRCm39) I67F probably benign Het
Fam161b G A 12: 84,395,332 (GRCm39) probably benign Het
Gata5 A T 2: 179,969,172 (GRCm39) C345* probably null Het
Glmp T C 3: 88,235,581 (GRCm39) V47A probably damaging Het
Gm9762 T A 3: 78,873,857 (GRCm39) noncoding transcript Het
Gnas A T 2: 174,139,873 (GRCm39) D14V probably damaging Het
Gnl3 T C 14: 30,739,286 (GRCm39) S53G probably damaging Het
Grhl3 C T 4: 135,275,777 (GRCm39) V527M probably damaging Het
Hoxd10 T A 2: 74,524,531 (GRCm39) L281* probably null Het
Kif16b T G 2: 142,532,614 (GRCm39) Y1175S probably benign Het
Kif2b A G 11: 91,467,672 (GRCm39) S204P probably benign Het
Klhl40 T A 9: 121,607,800 (GRCm39) I320N probably damaging Het
Ksr2 G A 5: 117,846,212 (GRCm39) R693Q probably damaging Het
Mis12 A G 11: 70,916,152 (GRCm39) K62E possibly damaging Het
Mlc1 A G 15: 88,858,980 (GRCm39) C102R probably damaging Het
Muc5b T C 7: 141,411,098 (GRCm39) I1348T unknown Het
Myh7b A G 2: 155,471,242 (GRCm39) E1130G probably damaging Het
Nat8f4 T C 6: 85,878,368 (GRCm39) T52A probably benign Het
Nxpe2 C A 9: 48,231,821 (GRCm39) V379L probably benign Het
Or10ad1c G A 15: 98,084,749 (GRCm39) R310W probably damaging Het
Or4c1 C A 2: 89,133,246 (GRCm39) S230I possibly damaging Het
Or4c1 T A 2: 89,133,247 (GRCm39) S230C probably damaging Het
Or5b111 A T 19: 13,291,081 (GRCm39) D189E probably benign Het
Or5b12 C T 19: 12,897,298 (GRCm39) C125Y probably damaging Het
Pcdhga7 A T 18: 37,850,261 (GRCm39) Y756F probably damaging Het
Pcsk6 T A 7: 65,608,989 (GRCm39) Y284N probably damaging Het
Pdcd11 T C 19: 47,114,786 (GRCm39) V1367A possibly damaging Het
Postn T A 3: 54,282,492 (GRCm39) N484K probably damaging Het
Prkd3 C T 17: 79,268,600 (GRCm39) V572I probably benign Het
Qser1 T C 2: 104,617,528 (GRCm39) S1005G probably benign Het
Radil G T 5: 142,472,556 (GRCm39) D951E probably benign Het
Ripk1 C T 13: 34,211,925 (GRCm39) R352* probably null Het
Sacs T C 14: 61,450,196 (GRCm39) F4081L probably benign Het
Sbf1 A G 15: 89,199,288 (GRCm39) V11A possibly damaging Het
Sgip1 T A 4: 102,791,784 (GRCm39) F536I probably damaging Het
Slc45a1 A G 4: 150,722,741 (GRCm39) L381P probably damaging Het
Smarcad1 C T 6: 65,029,625 (GRCm39) P71L probably benign Het
Spns1 T A 7: 125,976,209 (GRCm39) D14V probably damaging Het
Sv2c T A 13: 96,122,526 (GRCm39) I417F possibly damaging Het
Tas2r113 T A 6: 132,870,479 (GRCm39) M169K probably benign Het
Tgm1 A T 14: 55,943,138 (GRCm39) N567K probably benign Het
Thoc2l A G 5: 104,670,106 (GRCm39) K1543E probably benign Het
Tln2 C T 9: 67,302,743 (GRCm39) R76Q probably damaging Het
Trpm6 T C 19: 18,831,155 (GRCm39) V1340A probably benign Het
Tspan18 A T 2: 93,142,375 (GRCm39) probably null Het
Txndc11 C T 16: 10,902,178 (GRCm39) V679I probably damaging Het
Usf1 G T 1: 171,244,532 (GRCm39) G144V possibly damaging Het
Vmn1r59 T C 7: 5,457,451 (GRCm39) Y103C probably damaging Het
Vmn2r79 A T 7: 86,687,168 (GRCm39) I850F probably damaging Het
Vps35l T A 7: 118,390,671 (GRCm39) I455N probably damaging Het
Wdr90 C T 17: 26,074,337 (GRCm39) R676H probably benign Het
Zfp867 G A 11: 59,354,487 (GRCm39) R281W probably damaging Het
Zfp939 T C 7: 39,122,366 (GRCm39) noncoding transcript Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCATTGGCCAACCTGGAAC -3'
(R):5'- AGCTGTCAGGTAGCCTTCTCAC -3'

Sequencing Primer
(F):5'- GAACAGTCACTTGTGTCTTGAGAC -3'
(R):5'- GGTAGCCTTCTCACCAGAAAAG -3'
Posted On 2015-10-21