Incidental Mutation 'R4697:Ednra'
ID 355782
Institutional Source Beutler Lab
Gene Symbol Ednra
Ensembl Gene ENSMUSG00000031616
Gene Name endothelin receptor type A
Synonyms Gpcr10, ET-AR, ETa
MMRRC Submission 041947-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4697 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 77663031-77724464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77664995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 422 (H422R)
Ref Sequence ENSEMBL: ENSMUSP00000034029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034029]
AlphaFold Q61614
Predicted Effect probably benign
Transcript: ENSMUST00000034029
AA Change: H422R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034029
Gene: ENSMUSG00000031616
AA Change: H422R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:7tm_1 97 370 8.4e-36 PFAM
low complexity region 376 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211466
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this gene results in numerous severe craniofacial defects and perinatal lethality. Aberrant middle ear development and cardiac defects, including great vessel malformations and abnormal cardiac outflow tract development, have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Ednra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ednra APN 8 77675071 missense probably damaging 1.00
IGL02943:Ednra APN 8 77720054 missense probably damaging 1.00
IGL03213:Ednra APN 8 77720219 missense probably benign
Starved UTSW 8 77675067 missense possibly damaging 0.82
R0058:Ednra UTSW 8 77667322 critical splice donor site probably null
R0080:Ednra UTSW 8 77675059 missense probably benign
R0894:Ednra UTSW 8 77720020 splice site probably benign
R1746:Ednra UTSW 8 77671582 missense probably benign 0.44
R1872:Ednra UTSW 8 77720396 missense possibly damaging 0.46
R1934:Ednra UTSW 8 77689118 missense possibly damaging 0.55
R3776:Ednra UTSW 8 77675095 missense probably damaging 1.00
R4177:Ednra UTSW 8 77675048 missense possibly damaging 0.54
R4274:Ednra UTSW 8 77720302 missense probably benign 0.01
R4544:Ednra UTSW 8 77674911 critical splice donor site probably null
R4704:Ednra UTSW 8 77667963 intron probably benign
R4863:Ednra UTSW 8 77667383 missense probably damaging 1.00
R5265:Ednra UTSW 8 77667375 missense probably damaging 1.00
R5346:Ednra UTSW 8 77674968 missense probably damaging 1.00
R5772:Ednra UTSW 8 77675067 missense possibly damaging 0.82
R6005:Ednra UTSW 8 77674927 missense possibly damaging 0.91
R6147:Ednra UTSW 8 77667322 critical splice donor site probably benign
R6384:Ednra UTSW 8 77689094 missense probably damaging 1.00
R6743:Ednra UTSW 8 77675089 missense probably damaging 0.99
R7084:Ednra UTSW 8 77665105 nonsense probably null
R8345:Ednra UTSW 8 77689184 missense probably damaging 1.00
R9421:Ednra UTSW 8 77665052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCATTGGCTATAGCTGG -3'
(R):5'- TGTCTGGCTAGGACAAGCTC -3'

Sequencing Primer
(F):5'- CATTGGCTATAGCTGGGACCG -3'
(R):5'- CAAGCTTCCTGTGTGACTCAGAATG -3'
Posted On 2015-10-21