Mutagenetix > Incidental Mutation

Incidental Mutation 'R4697:Tln2'

355784

Institutional Source

Beutler Lab

Gene Symbol

Tln2

Ensembl Gene

ENSMUSG00000052698

Gene Name

talin 2

Synonyms

MMRRC Submission

041947-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R4697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67217087-67559703 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 67395461 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 76 (R76Q)

Ref Sequence

ENSEMBL: ENSMUSP00000039633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000213584] [ENSMUST00000215784]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039662
AA Change: R76Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: R76Q

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	3.4e-59	PFAM
Pfam:I_LWEQ	661	765	1.9e-10	PFAM
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	2.6e-67	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2384	2531	2.5e-52	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000040025
AA Change: R76Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: R76Q

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	8.5e-78	PFAM
low complexity region	674	693	N/A	INTRINSIC
internal_repeat_2	703	763	2.05e-7	PROSPERO
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	9.9e-72	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2383	2533	4.3e-51	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213584
AA Change: R78Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215784
AA Change: R78Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.2693

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,791,448	I455N	probably damaging	Het
A2m	T	C	6: 121,638,284	M1T	probably null	Het
Aatf	T	A	11: 84,449,138	D449V	probably damaging	Het
Acbd3	T	A	1: 180,721,944		probably benign	Het
BC005561	A	G	5: 104,522,240	K1543E	probably benign	Het
Bicc1	T	A	10: 70,953,484	I366F	possibly damaging	Het
Ccdc74a	T	C	16: 17,649,749	S184P	possibly damaging	Het
Cntn4	T	C	6: 106,525,485	V401A	probably damaging	Het
Cux2	T	C	5: 121,873,753	T540A	probably damaging	Het
Disp2	G	T	2: 118,791,684	E966*	probably null	Het
Dpp7	A	G	2: 25,354,919	Y209H	probably benign	Het
Dstyk	T	A	1: 132,449,487	F277Y	probably damaging	Het
Dtx1	A	T	5: 120,694,408		probably null	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Ednra	T	C	8: 77,664,995	H422R	probably benign	Het
Erlec1	T	A	11: 30,952,640	I67F	probably benign	Het
Fam161b	G	A	12: 84,348,558		probably benign	Het
Gata5	A	T	2: 180,327,379	C345*	probably null	Het
Glmp	T	C	3: 88,328,274	V47A	probably damaging	Het
Gm9762	T	A	3: 78,966,550		noncoding transcript	Het
Gnas	A	T	2: 174,298,080	D14V	probably damaging	Het
Gnl3	T	C	14: 31,017,329	S53G	probably damaging	Het
Grhl3	C	T	4: 135,548,466	V527M	probably damaging	Het
Hoxd10	T	A	2: 74,694,187	L281*	probably null	Het
Kif16b	T	G	2: 142,690,694	Y1175S	probably benign	Het
Kif2b	A	G	11: 91,576,846	S204P	probably benign	Het
Klhl40	T	A	9: 121,778,734	I320N	probably damaging	Het
Ksr2	G	A	5: 117,708,147	R693Q	probably damaging	Het
Mis12	A	G	11: 71,025,326	K62E	possibly damaging	Het
Mlc1	A	G	15: 88,974,777	C102R	probably damaging	Het
Muc5b	T	C	7: 141,857,361	I1348T	unknown	Het
Myh7b	A	G	2: 155,629,322	E1130G	probably damaging	Het
Nat8f4	T	C	6: 85,901,386	T52A	probably benign	Het
Nxpe2	C	A	9: 48,320,521	V379L	probably benign	Het
Olfr1231	C	A	2: 89,302,902	S230I	possibly damaging	Het
Olfr1231	T	A	2: 89,302,903	S230C	probably damaging	Het
Olfr1448	C	T	19: 12,919,934	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,313,717	D189E	probably benign	Het
Olfr288	G	A	15: 98,186,868	R310W	probably damaging	Het
Pcdhga7	A	T	18: 37,717,208	Y756F	probably damaging	Het
Pcsk6	T	A	7: 65,959,241	Y284N	probably damaging	Het
Pdcd11	T	C	19: 47,126,347	V1367A	possibly damaging	Het
Postn	T	A	3: 54,375,071	N484K	probably damaging	Het
Prkd3	C	T	17: 78,961,171	V572I	probably benign	Het
Qser1	T	C	2: 104,787,183	S1005G	probably benign	Het
Radil	G	T	5: 142,486,801	D951E	probably benign	Het
Ripk1	C	T	13: 34,027,942	R352*	probably null	Het
Sacs	T	C	14: 61,212,747	F4081L	probably benign	Het
Sbf1	A	G	15: 89,315,085	V11A	possibly damaging	Het
Sgip1	T	A	4: 102,934,587	F536I	probably damaging	Het
Slc45a1	A	G	4: 150,638,284	L381P	probably damaging	Het
Smarcad1	C	T	6: 65,052,641	P71L	probably benign	Het
Spns1	T	A	7: 126,377,037	D14V	probably damaging	Het
Sv2c	T	A	13: 95,986,018	I417F	possibly damaging	Het
Tas2r113	T	A	6: 132,893,516	M169K	probably benign	Het
Tgm1	A	T	14: 55,705,681	N567K	probably benign	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Tspan18	A	T	2: 93,312,030		probably null	Het
Txndc11	C	T	16: 11,084,314	V679I	probably damaging	Het
Usf1	G	T	1: 171,416,964	G144V	possibly damaging	Het
Vmn1r59	T	C	7: 5,454,452	Y103C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,826	I713F	probably damaging	Het
Vmn2r79	A	T	7: 87,037,960	I850F	probably damaging	Het
Wdr90	C	T	17: 25,855,363	R676H	probably benign	Het
Zfp867	G	A	11: 59,463,661	R281W	probably damaging	Het
Zfp939	T	C	7: 39,472,942		noncoding transcript	Het

Other mutations in Tln2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tln2	APN	9	67344187	missense	possibly damaging	0.59
IGL01110:Tln2	APN	9	67250582	nonsense	probably null
IGL01112:Tln2	APN	9	67311811	missense	probably damaging	1.00
IGL01307:Tln2	APN	9	67395467	missense	probably benign	0.25
IGL01374:Tln2	APN	9	67261923	missense	probably damaging	1.00
IGL01625:Tln2	APN	9	67370623	missense	probably damaging	1.00
IGL01865:Tln2	APN	9	67250614	nonsense	probably null
IGL01999:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02002:Tln2	APN	9	67356698	missense	probably damaging	0.98
IGL02005:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02015:Tln2	APN	9	67361439	splice site	probably benign
IGL02368:Tln2	APN	9	67240810	splice site	probably benign
IGL02444:Tln2	APN	9	67258592	splice site	probably benign
IGL02646:Tln2	APN	9	67255996	missense	probably benign	0.43
IGL02744:Tln2	APN	9	67229376	nonsense	probably null
IGL02869:Tln2	APN	9	67221525	splice site	probably benign
IGL02930:Tln2	APN	9	67393662	nonsense	probably null
IGL03100:Tln2	APN	9	67295737	missense	probably damaging	1.00
IGL03326:Tln2	APN	9	67334257	missense	possibly damaging	0.67
Harrier	UTSW	9	67330552	nonsense	probably null
Marsh	UTSW	9	67272654	missense	probably benign	0.19
BB008:Tln2	UTSW	9	67258460	critical splice donor site	probably null
BB018:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0107:Tln2	UTSW	9	67370706	missense	probably damaging	1.00
R0494:Tln2	UTSW	9	67355197	missense	probably benign	0.22
R0884:Tln2	UTSW	9	67370733	missense	probably damaging	1.00
R0947:Tln2	UTSW	9	67295813	missense	probably benign	0.08
R0989:Tln2	UTSW	9	67229454	missense	probably damaging	1.00
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1486:Tln2	UTSW	9	67311839	missense	probably damaging	1.00
R1527:Tln2	UTSW	9	67272668	missense	possibly damaging	0.95
R1584:Tln2	UTSW	9	67296414	missense	probably damaging	1.00
R1636:Tln2	UTSW	9	67306532	missense	probably damaging	1.00
R1656:Tln2	UTSW	9	67227107	missense	possibly damaging	0.81
R1707:Tln2	UTSW	9	67375807	missense	probably benign	0.00
R1749:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1751:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1761:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1767:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1815:Tln2	UTSW	9	67229423	missense	probably damaging	1.00
R1840:Tln2	UTSW	9	67342043	missense	probably damaging	1.00
R1847:Tln2	UTSW	9	67362687	nonsense	probably null
R1964:Tln2	UTSW	9	67342135	missense	probably benign	0.00
R1968:Tln2	UTSW	9	67255901	missense	probably damaging	1.00
R2036:Tln2	UTSW	9	67272704	missense	possibly damaging	0.76
R2038:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R2152:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2153:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2154:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2191:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2192:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2201:Tln2	UTSW	9	67375757	missense	probably damaging	1.00
R3116:Tln2	UTSW	9	67355139	missense	probably benign	0.10
R3151:Tln2	UTSW	9	67330547	critical splice donor site	probably null
R3795:Tln2	UTSW	9	67255915	missense	probably damaging	0.97
R3953:Tln2	UTSW	9	67370629	missense	probably damaging	1.00
R4450:Tln2	UTSW	9	67344065	critical splice donor site	probably null
R4685:Tln2	UTSW	9	67302572	missense	probably damaging	1.00
R4688:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R4696:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4700:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4701:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4741:Tln2	UTSW	9	67386555	critical splice donor site	probably null
R4806:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4807:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4808:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4967:Tln2	UTSW	9	67355125	missense	probably damaging	0.97
R5061:Tln2	UTSW	9	67354468	missense	probably benign
R5092:Tln2	UTSW	9	67256028	missense	probably benign	0.13
R5093:Tln2	UTSW	9	67334314	missense	probably benign	0.44
R5126:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R5204:Tln2	UTSW	9	67354482	missense	probably benign	0.00
R5236:Tln2	UTSW	9	67365923	missense	probably damaging	0.99
R5287:Tln2	UTSW	9	67242359	missense	probably damaging	1.00
R5568:Tln2	UTSW	9	67311865	missense	probably damaging	1.00
R5571:Tln2	UTSW	9	67334320	missense	possibly damaging	0.88
R5642:Tln2	UTSW	9	67296358	missense	probably benign	0.01
R5711:Tln2	UTSW	9	67392547	missense	probably benign	0.00
R5776:Tln2	UTSW	9	67258250	missense	probably damaging	1.00
R5791:Tln2	UTSW	9	67386605	missense	probably damaging	0.98
R5866:Tln2	UTSW	9	67266868	missense	probably damaging	1.00
R5888:Tln2	UTSW	9	67229403	missense	probably damaging	1.00
R5902:Tln2	UTSW	9	67362717	missense	probably benign	0.02
R6106:Tln2	UTSW	9	67323020	missense	probably damaging	0.99
R6175:Tln2	UTSW	9	67224081	missense	probably damaging	1.00
R6385:Tln2	UTSW	9	67278129	missense	probably benign	0.45
R6430:Tln2	UTSW	9	67272665	missense	probably damaging	1.00
R6441:Tln2	UTSW	9	67272689	missense	probably damaging	1.00
R6738:Tln2	UTSW	9	67386664	missense	possibly damaging	0.91
R6776:Tln2	UTSW	9	67262905	missense	probably damaging	1.00
R6794:Tln2	UTSW	9	67286558	missense	probably benign	0.07
R6850:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R6907:Tln2	UTSW	9	67397635	missense	probably damaging	0.98
R6909:Tln2	UTSW	9	67392532	missense	probably damaging	0.97
R6951:Tln2	UTSW	9	67258485	missense	probably damaging	0.97
R7015:Tln2	UTSW	9	67362647	missense	possibly damaging	0.55
R7051:Tln2	UTSW	9	67346417	missense	probably benign	0.00
R7246:Tln2	UTSW	9	67262979	missense	probably damaging	1.00
R7292:Tln2	UTSW	9	67346461	missense	probably benign
R7753:Tln2	UTSW	9	67395473	missense	probably damaging	1.00
R7868:Tln2	UTSW	9	67348226	missense	probably damaging	1.00
R7931:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R8023:Tln2	UTSW	9	67224064	missense	probably damaging	1.00
R8081:Tln2	UTSW	9	67356747	missense	probably damaging	1.00
R8164:Tln2	UTSW	9	67319420	missense	probably benign	0.31
R8192:Tln2	UTSW	9	67346529	nonsense	probably null
R8495:Tln2	UTSW	9	67354467	missense	probably benign	0.01
R8734:Tln2	UTSW	9	67272654	missense	probably benign	0.19
R8739:Tln2	UTSW	9	67258273	missense	probably damaging	1.00
R8757:Tln2	UTSW	9	67367218	missense	probably damaging	1.00
R8759:Tln2	UTSW	9	67367218	missense	probably damaging	1.00
R8770:Tln2	UTSW	9	67323022	missense	probably benign
R8781:Tln2	UTSW	9	67255951	missense	probably damaging	1.00
R8812:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8814:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8816:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8816:Tln2	UTSW	9	67221517	missense	probably damaging	1.00
R8833:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8835:Tln2	UTSW	9	67397693	splice site	probably benign
R8837:Tln2	UTSW	9	67250584	missense	probably damaging	0.99
R8843:Tln2	UTSW	9	67395545	missense	probably damaging	1.00
R8864:Tln2	UTSW	9	67330552	nonsense	probably null
R8867:Tln2	UTSW	9	67330550	missense	probably damaging	0.98
R8921:Tln2	UTSW	9	67266823	missense	probably damaging	0.99
R9080:Tln2	UTSW	9	67346561	missense	probably damaging	1.00
R9083:Tln2	UTSW	9	67362645	missense	probably damaging	0.96
R9150:Tln2	UTSW	9	67221496	missense	probably damaging	1.00
R9287:Tln2	UTSW	9	67370698	missense	probably benign	0.20
R9330:Tln2	UTSW	9	67321931	missense	possibly damaging	0.61
R9343:Tln2	UTSW	9	67323071	missense	probably benign	0.10
R9355:Tln2	UTSW	9	67355247	missense	possibly damaging	0.46
R9383:Tln2	UTSW	9	67370761	missense	probably benign	0.17
R9386:Tln2	UTSW	9	67365967	missense	possibly damaging	0.78
R9407:Tln2	UTSW	9	67229450	missense	probably damaging	1.00
R9483:Tln2	UTSW	9	67392487	missense	probably damaging	1.00
R9523:Tln2	UTSW	9	67258484	missense	probably damaging	0.99
R9642:Tln2	UTSW	9	67250544	missense	probably benign	0.02
R9703:Tln2	UTSW	9	67386656	missense	probably damaging	1.00
X0027:Tln2	UTSW	9	67376853	missense	probably damaging	1.00
X0064:Tln2	UTSW	9	67348138	missense	probably damaging	1.00
X0067:Tln2	UTSW	9	67370691	missense	probably damaging	1.00
Z1176:Tln2	UTSW	9	67346485	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TTCCATAGGTAGCTCCCCAG -3'
(R):5'- GTGATGGACAGTATCGTCCTCC -3'

Sequencing Primer
(F):5'- TGGCACCAAGACTGTTTAGC -3'
(R):5'- GATGGACAGTATCGTCCTCCTTTCTG -3'

Posted On

2015-10-21