Mutagenetix > Incidental Mutations

Incidental Mutation 'R4697:Aatf'

355790

Institutional Source

Beutler Lab

Gene Symbol

Aatf

Ensembl Gene

ENSMUSG00000018697

Gene Name

apoptosis antagonizing transcription factor

Synonyms

Trb, 4933415H02Rik, 5830465M17Rik, Che-1

MMRRC Submission

041947-MU

Accession Numbers

NCBI RefSeq: NM_019816.1; MGI:1929608

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84422855-84513522 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84449138 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 449 (D449V)

Ref Sequence

ENSEMBL: ENSMUSP00000018841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018841]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018841
AA Change: D449V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018841
Gene: ENSMUSG00000018697
AA Change: D449V

Domain	Start	End	E-Value	Type
low complexity region	2	35	N/A	INTRINSIC
low complexity region	91	119	N/A	INTRINSIC
low complexity region	130	173	N/A	INTRINSIC
Pfam:AATF-Che1	187	339	4.6e-40	PFAM
low complexity region	418	429	N/A	INTRINSIC
Pfam:TRAUB	430	514	3.2e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141093

Meta Mutation Damage Score

0.2030

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

96% (75/78)

MGI Phenotype

Strain: 2176283
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction. Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity. Severely reduced cell proliferation is observed before blastocyst formation. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted(2) Gene trapped(18)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,791,448	I455N	probably damaging	Het
A2m	T	C	6: 121,638,284	M1T	probably null	Het
Acbd3	T	A	1: 180,721,944		probably benign	Het
BC005561	A	G	5: 104,522,240	K1543E	probably benign	Het
Bicc1	T	A	10: 70,953,484	I366F	possibly damaging	Het
Ccdc74a	T	C	16: 17,649,749	S184P	possibly damaging	Het
Cntn4	T	C	6: 106,525,485	V401A	probably damaging	Het
Cux2	T	C	5: 121,873,753	T540A	probably damaging	Het
Disp2	G	T	2: 118,791,684	E966*	probably null	Het
Dpp7	A	G	2: 25,354,919	Y209H	probably benign	Het
Dstyk	T	A	1: 132,449,487	F277Y	probably damaging	Het
Dtx1	A	T	5: 120,694,408		probably null	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Ednra	T	C	8: 77,664,995	H422R	probably benign	Het
Erlec1	T	A	11: 30,952,640	I67F	probably benign	Het
Fam161b	G	A	12: 84,348,558		probably benign	Het
Gata5	A	T	2: 180,327,379	C345*	probably null	Het
Glmp	T	C	3: 88,328,274	V47A	probably damaging	Het
Gm9762	T	A	3: 78,966,550		noncoding transcript	Het
Gnas	A	T	2: 174,298,080	D14V	probably damaging	Het
Gnl3	T	C	14: 31,017,329	S53G	probably damaging	Het
Grhl3	C	T	4: 135,548,466	V527M	probably damaging	Het
Hoxd10	T	A	2: 74,694,187	L281*	probably null	Het
Kif16b	T	G	2: 142,690,694	Y1175S	probably benign	Het
Kif2b	A	G	11: 91,576,846	S204P	probably benign	Het
Klhl40	T	A	9: 121,778,734	I320N	probably damaging	Het
Ksr2	G	A	5: 117,708,147	R693Q	probably damaging	Het
Mis12	A	G	11: 71,025,326	K62E	possibly damaging	Het
Mlc1	A	G	15: 88,974,777	C102R	probably damaging	Het
Muc5b	T	C	7: 141,857,361	I1348T	unknown	Het
Myh7b	A	G	2: 155,629,322	E1130G	probably damaging	Het
Nat8f4	T	C	6: 85,901,386	T52A	probably benign	Het
Nxpe2	C	A	9: 48,320,521	V379L	probably benign	Het
Olfr1231	C	A	2: 89,302,902	S230I	possibly damaging	Het
Olfr1231	T	A	2: 89,302,903	S230C	probably damaging	Het
Olfr1448	C	T	19: 12,919,934	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,313,717	D189E	probably benign	Het
Olfr288	G	A	15: 98,186,868	R310W	probably damaging	Het
Pcdhga7	A	T	18: 37,717,208	Y756F	probably damaging	Het
Pcsk6	T	A	7: 65,959,241	Y284N	probably damaging	Het
Pdcd11	T	C	19: 47,126,347	V1367A	possibly damaging	Het
Postn	T	A	3: 54,375,071	N484K	probably damaging	Het
Prkd3	C	T	17: 78,961,171	V572I	probably benign	Het
Qser1	T	C	2: 104,787,183	S1005G	probably benign	Het
Radil	G	T	5: 142,486,801	D951E	probably benign	Het
Ripk1	C	T	13: 34,027,942	R352*	probably null	Het
Sacs	T	C	14: 61,212,747	F4081L	probably benign	Het
Sbf1	A	G	15: 89,315,085	V11A	possibly damaging	Het
Sgip1	T	A	4: 102,934,587	F536I	probably damaging	Het
Slc45a1	A	G	4: 150,638,284	L381P	probably damaging	Het
Smarcad1	C	T	6: 65,052,641	P71L	probably benign	Het
Spns1	T	A	7: 126,377,037	D14V	probably damaging	Het
Sv2c	T	A	13: 95,986,018	I417F	possibly damaging	Het
Tas2r113	T	A	6: 132,893,516	M169K	probably benign	Het
Tgm1	A	T	14: 55,705,681	N567K	probably benign	Het
Tln2	C	T	9: 67,395,461	R76Q	probably damaging	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Tspan18	A	T	2: 93,312,030		probably null	Het
Txndc11	C	T	16: 11,084,314	V679I	probably damaging	Het
Usf1	G	T	1: 171,416,964	G144V	possibly damaging	Het
Vmn1r59	T	C	7: 5,454,452	Y103C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,826	I713F	probably damaging	Het
Vmn2r79	A	T	7: 87,037,960	I850F	probably damaging	Het
Wdr90	C	T	17: 25,855,363	R676H	probably benign	Het
Zfp867	G	A	11: 59,463,661	R281W	probably damaging	Het
Zfp939	T	C	7: 39,472,942		noncoding transcript	Het

Other mutations in Aatf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00900:Aatf	APN	11	84470557	splice site	probably benign
IGL01482:Aatf	APN	11	84470710	missense	possibly damaging	0.51
IGL01775:Aatf	APN	11	84471137	missense	probably damaging	1.00
IGL02881:Aatf	APN	11	84471289	splice site	probably benign
R0183:Aatf	UTSW	11	84510425	splice site	probably null
R0200:Aatf	UTSW	11	84445676	missense	probably damaging	1.00
R0257:Aatf	UTSW	11	84510281	missense	probably benign	0.33
R0324:Aatf	UTSW	11	84512139	critical splice donor site	probably null
R0494:Aatf	UTSW	11	84511513	missense	probably benign
R0544:Aatf	UTSW	11	84423005	missense	probably benign	0.09
R1186:Aatf	UTSW	11	84470549	splice site	probably benign
R2339:Aatf	UTSW	11	84511497	missense	probably benign	0.00
R4626:Aatf	UTSW	11	84422958	makesense	probably null
R4647:Aatf	UTSW	11	84471197	missense	possibly damaging	0.69
R4981:Aatf	UTSW	11	84511497	missense	probably benign	0.00
R5490:Aatf	UTSW	11	84510273	missense	probably damaging	1.00
R5938:Aatf	UTSW	11	84442574	missense	possibly damaging	0.88
R6267:Aatf	UTSW	11	84473100	missense	probably benign	0.09
R6296:Aatf	UTSW	11	84473100	missense	probably benign	0.09
R6633:Aatf	UTSW	11	84511482	critical splice donor site	probably null
R7081:Aatf	UTSW	11	84471125	missense	possibly damaging	0.84
R7212:Aatf	UTSW	11	84449180	missense	probably damaging	0.98
R7545:Aatf	UTSW	11	84470676	missense	probably benign	0.04
R7754:Aatf	UTSW	11	84511509	missense	possibly damaging	0.53
R7871:Aatf	UTSW	11	84471038	frame shift	probably null
R8411:Aatf	UTSW	11	84470676	missense	probably benign	0.04
X0018:Aatf	UTSW	11	84510385	missense	possibly damaging	0.85
Z1176:Aatf	UTSW	11	84442585	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CGTTACACACTGGTCAGCAG -3'
(R):5'- GTTAGCTACCTTTGAAAACGCCG -3'

Sequencing Primer
(F):5'- GTTACACACTGGTCAGCAGATTGC -3'
(R):5'- TTTGAAAACGCCGTAAATACAACAGG -3'

Posted On

2015-10-21