Incidental Mutation 'R4697:Aatf'
ID 355790
Institutional Source Beutler Lab
Gene Symbol Aatf
Ensembl Gene ENSMUSG00000018697
Gene Name apoptosis antagonizing transcription factor
Synonyms Trb, 4933415H02Rik, 5830465M17Rik, Che-1
MMRRC Submission 041947-MU
Accession Numbers

NCBI RefSeq: NM_019816.1; MGI:1929608
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4697 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 84422855-84513522 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84449138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 449 (D449V)
Ref Sequence ENSEMBL: ENSMUSP00000018841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018841]
AlphaFold Q9JKX4
Predicted Effect probably damaging
Transcript: ENSMUST00000018841
AA Change: D449V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018841
Gene: ENSMUSG00000018697
AA Change: D449V

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 91 119 N/A INTRINSIC
low complexity region 130 173 N/A INTRINSIC
Pfam:AATF-Che1 187 339 4.6e-40 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:TRAUB 430 514 3.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141093
Meta Mutation Damage Score 0.2030 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype Strain: 2176283
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction. Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity. Severely reduced cell proliferation is observed before blastocyst formation. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(2) Gene trapped(18) 
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Aatf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Aatf APN 11 84470557 splice site probably benign
IGL01482:Aatf APN 11 84470710 missense possibly damaging 0.51
IGL01775:Aatf APN 11 84471137 missense probably damaging 1.00
IGL02881:Aatf APN 11 84471289 splice site probably benign
R0183:Aatf UTSW 11 84510425 splice site probably null
R0200:Aatf UTSW 11 84445676 missense probably damaging 1.00
R0257:Aatf UTSW 11 84510281 missense probably benign 0.33
R0324:Aatf UTSW 11 84512139 critical splice donor site probably null
R0494:Aatf UTSW 11 84511513 missense probably benign
R0544:Aatf UTSW 11 84423005 missense probably benign 0.09
R1186:Aatf UTSW 11 84470549 splice site probably benign
R2339:Aatf UTSW 11 84511497 missense probably benign 0.00
R4626:Aatf UTSW 11 84422958 makesense probably null
R4647:Aatf UTSW 11 84471197 missense possibly damaging 0.69
R4981:Aatf UTSW 11 84511497 missense probably benign 0.00
R5490:Aatf UTSW 11 84510273 missense probably damaging 1.00
R5938:Aatf UTSW 11 84442574 missense possibly damaging 0.88
R6267:Aatf UTSW 11 84473100 missense probably benign 0.09
R6296:Aatf UTSW 11 84473100 missense probably benign 0.09
R6633:Aatf UTSW 11 84511482 critical splice donor site probably null
R7081:Aatf UTSW 11 84471125 missense possibly damaging 0.84
R7212:Aatf UTSW 11 84449180 missense probably damaging 0.98
R7545:Aatf UTSW 11 84470676 missense probably benign 0.04
R7754:Aatf UTSW 11 84511509 missense possibly damaging 0.53
R7871:Aatf UTSW 11 84471038 frame shift probably null
R8411:Aatf UTSW 11 84470676 missense probably benign 0.04
R8746:Aatf UTSW 11 84511512 missense probably benign 0.06
R9406:Aatf UTSW 11 84471040 frame shift probably null
X0018:Aatf UTSW 11 84510385 missense possibly damaging 0.85
Z1176:Aatf UTSW 11 84442585 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTTACACACTGGTCAGCAG -3'
(R):5'- GTTAGCTACCTTTGAAAACGCCG -3'

Sequencing Primer
(F):5'- GTTACACACTGGTCAGCAGATTGC -3'
(R):5'- TTTGAAAACGCCGTAAATACAACAGG -3'
Posted On 2015-10-21