Incidental Mutation 'R4697:Ripk1'
ID355793
Institutional Source Beutler Lab
Gene Symbol Ripk1
Ensembl Gene ENSMUSG00000021408
Gene Namereceptor (TNFRSF)-interacting serine-threonine kinase 1
SynonymsRinp, Rip1
MMRRC Submission 041947-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4697 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location34002363-34037147 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 34027942 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 352 (R352*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021844] [ENSMUST00000167374]
Predicted Effect probably null
Transcript: ENSMUST00000021844
AA Change: R412*
SMART Domains Protein: ENSMUSP00000021844
Gene: ENSMUSG00000021408
AA Change: R412*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 286 1.2e-52 PFAM
Pfam:Pkinase 18 286 6.2e-51 PFAM
Pfam:Kinase-like 84 247 7.4e-8 PFAM
Pfam:RHIM 480 538 5.9e-10 PFAM
DEATH 558 654 1.2e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167374
AA Change: R412*
SMART Domains Protein: ENSMUSP00000129831
Gene: ENSMUSG00000021408
AA Change: R412*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 286 5.2e-54 PFAM
Pfam:Pkinase 18 286 1.1e-53 PFAM
Pfam:RHIM 493 539 5.2e-16 PFAM
DEATH 558 654 1.2e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171137
AA Change: R352*
SMART Domains Protein: ENSMUSP00000128511
Gene: ENSMUSG00000021408
AA Change: R352*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 116 2.6e-14 PFAM
Pfam:Pkinase 5 109 1.7e-14 PFAM
Pfam:Pkinase 92 227 2.9e-14 PFAM
Pfam:Pkinase_Tyr 94 227 2.9e-21 PFAM
Pfam:RHIM 421 479 2.3e-10 PFAM
DEATH 499 595 1.2e-25 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die within 1 and 3 days of birth displaying extensive apoptosis in both lymphoid and adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Ripk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Ripk1 APN 13 34015268 missense probably damaging 0.96
IGL01873:Ripk1 APN 13 34009724 missense probably damaging 1.00
IGL02383:Ripk1 APN 13 34015244 missense probably damaging 1.00
IGL02478:Ripk1 APN 13 34010589 missense probably damaging 1.00
R0115:Ripk1 UTSW 13 34009750 missense probably damaging 1.00
R0481:Ripk1 UTSW 13 34009750 missense probably damaging 1.00
R0630:Ripk1 UTSW 13 34027781 missense probably damaging 1.00
R1105:Ripk1 UTSW 13 34028167 missense probably benign
R1528:Ripk1 UTSW 13 34028147 missense probably benign 0.01
R1834:Ripk1 UTSW 13 34015213 missense probably benign 0.00
R2294:Ripk1 UTSW 13 34017008 missense probably benign
R2384:Ripk1 UTSW 13 34030043 missense probably benign 0.03
R4510:Ripk1 UTSW 13 34026748 missense probably damaging 1.00
R4511:Ripk1 UTSW 13 34026748 missense probably damaging 1.00
R5078:Ripk1 UTSW 13 34017099 missense probably damaging 1.00
R5153:Ripk1 UTSW 13 34013296 missense probably damaging 1.00
R5974:Ripk1 UTSW 13 34030101 nonsense probably null
R6189:Ripk1 UTSW 13 34032501 missense probably benign 0.16
R6676:Ripk1 UTSW 13 34010604 missense probably damaging 1.00
R6905:Ripk1 UTSW 13 34027990 missense probably benign
R6997:Ripk1 UTSW 13 34017117 missense probably benign 0.00
R7009:Ripk1 UTSW 13 34030062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAACCTGGATCGCTGCAC -3'
(R):5'- CTGTAGTTCCAAATCCATGCTG -3'

Sequencing Primer
(F):5'- TGGATCGCTGCACAGTTC -3'
(R):5'- TCCATGCTGATTATACAATCCATTG -3'
Posted On2015-10-21