Mutagenetix > Incidental Mutations

Incidental Mutation 'R4697:Tgm1'

355796

Institutional Source

Beutler Lab

Gene Symbol

Tgm1

Ensembl Gene

ENSMUSG00000022218

Gene Name

transglutaminase 1, K polypeptide

Synonyms

TG K, TGase 1, protein-glutamine-gamma-glutamyltransferase, K polypeptide, 2310004J08Rik

MMRRC Submission

041947-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.912) question?

Stock #

R4697 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55700009-55713926 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55705681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 567 (N567K)

Ref Sequence

ENSEMBL: ENSMUSP00000137642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002389] [ENSMUST00000168729] [ENSMUST00000178034]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000002389
AA Change: N567K

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000002389
Gene: ENSMUSG00000022218
AA Change: N567K

Domain	Start	End	E-Value	Type
low complexity region	13	45	N/A	INTRINSIC
low complexity region	50	63	N/A	INTRINSIC
low complexity region	65	95	N/A	INTRINSIC
Pfam:Transglut_N	109	228	5.5e-35	PFAM
TGc	368	461	1.7e-43	SMART
low complexity region	550	561	N/A	INTRINSIC
Pfam:Transglut_C	578	682	1.5e-22	PFAM
Pfam:Transglut_C	690	787	1e-20	PFAM
low complexity region	788	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168729
AA Change: N567K

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000128090
Gene: ENSMUSG00000022218
AA Change: N567K

Domain	Start	End	E-Value	Type
low complexity region	13	45	N/A	INTRINSIC
low complexity region	50	63	N/A	INTRINSIC
low complexity region	65	95	N/A	INTRINSIC
Pfam:Transglut_N	109	228	5.5e-35	PFAM
TGc	368	461	1.7e-43	SMART
low complexity region	550	561	N/A	INTRINSIC
Pfam:Transglut_C	578	682	1.5e-22	PFAM
Pfam:Transglut_C	690	787	1e-20	PFAM
low complexity region	788	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178034
AA Change: N567K

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000137642
Gene: ENSMUSG00000022218
AA Change: N567K

Domain	Start	End	E-Value	Type
low complexity region	13	45	N/A	INTRINSIC
low complexity region	50	63	N/A	INTRINSIC
low complexity region	65	95	N/A	INTRINSIC
Pfam:Transglut_N	110	226	1.2e-32	PFAM
TGc	368	461	1.7e-43	SMART
low complexity region	550	561	N/A	INTRINSIC
Pfam:Transglut_C	578	682	3.6e-24	PFAM
Pfam:Transglut_C	690	787	1.3e-20	PFAM
low complexity region	788	804	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227106

Meta Mutation Damage Score

0.0953

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele are small and hypoactive and die within hours of birth displaying failure to suckle, progressive dehydration, and epidermal defects including a reddish, tight and wrinkled skin, hyperkeratosis, and impaired skin barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,791,448	I455N	probably damaging	Het
A2m	T	C	6: 121,638,284	M1T	probably null	Het
Aatf	T	A	11: 84,449,138	D449V	probably damaging	Het
Acbd3	T	A	1: 180,721,944		probably benign	Het
BC005561	A	G	5: 104,522,240	K1543E	probably benign	Het
Bicc1	T	A	10: 70,953,484	I366F	possibly damaging	Het
Ccdc74a	T	C	16: 17,649,749	S184P	possibly damaging	Het
Cntn4	T	C	6: 106,525,485	V401A	probably damaging	Het
Cux2	T	C	5: 121,873,753	T540A	probably damaging	Het
Disp2	G	T	2: 118,791,684	E966*	probably null	Het
Dpp7	A	G	2: 25,354,919	Y209H	probably benign	Het
Dstyk	T	A	1: 132,449,487	F277Y	probably damaging	Het
Dtx1	A	T	5: 120,694,408		probably null	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Ednra	T	C	8: 77,664,995	H422R	probably benign	Het
Erlec1	T	A	11: 30,952,640	I67F	probably benign	Het
Fam161b	G	A	12: 84,348,558		probably benign	Het
Gata5	A	T	2: 180,327,379	C345*	probably null	Het
Glmp	T	C	3: 88,328,274	V47A	probably damaging	Het
Gm9762	T	A	3: 78,966,550		noncoding transcript	Het
Gnas	A	T	2: 174,298,080	D14V	probably damaging	Het
Gnl3	T	C	14: 31,017,329	S53G	probably damaging	Het
Grhl3	C	T	4: 135,548,466	V527M	probably damaging	Het
Hoxd10	T	A	2: 74,694,187	L281*	probably null	Het
Kif16b	T	G	2: 142,690,694	Y1175S	probably benign	Het
Kif2b	A	G	11: 91,576,846	S204P	probably benign	Het
Klhl40	T	A	9: 121,778,734	I320N	probably damaging	Het
Ksr2	G	A	5: 117,708,147	R693Q	probably damaging	Het
Mis12	A	G	11: 71,025,326	K62E	possibly damaging	Het
Mlc1	A	G	15: 88,974,777	C102R	probably damaging	Het
Muc5b	T	C	7: 141,857,361	I1348T	unknown	Het
Myh7b	A	G	2: 155,629,322	E1130G	probably damaging	Het
Nat8f4	T	C	6: 85,901,386	T52A	probably benign	Het
Nxpe2	C	A	9: 48,320,521	V379L	probably benign	Het
Olfr1231	C	A	2: 89,302,902	S230I	possibly damaging	Het
Olfr1231	T	A	2: 89,302,903	S230C	probably damaging	Het
Olfr1448	C	T	19: 12,919,934	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,313,717	D189E	probably benign	Het
Olfr288	G	A	15: 98,186,868	R310W	probably damaging	Het
Pcdhga7	A	T	18: 37,717,208	Y756F	probably damaging	Het
Pcsk6	T	A	7: 65,959,241	Y284N	probably damaging	Het
Pdcd11	T	C	19: 47,126,347	V1367A	possibly damaging	Het
Postn	T	A	3: 54,375,071	N484K	probably damaging	Het
Prkd3	C	T	17: 78,961,171	V572I	probably benign	Het
Qser1	T	C	2: 104,787,183	S1005G	probably benign	Het
Radil	G	T	5: 142,486,801	D951E	probably benign	Het
Ripk1	C	T	13: 34,027,942	R352*	probably null	Het
Sacs	T	C	14: 61,212,747	F4081L	probably benign	Het
Sbf1	A	G	15: 89,315,085	V11A	possibly damaging	Het
Sgip1	T	A	4: 102,934,587	F536I	probably damaging	Het
Slc45a1	A	G	4: 150,638,284	L381P	probably damaging	Het
Smarcad1	C	T	6: 65,052,641	P71L	probably benign	Het
Spns1	T	A	7: 126,377,037	D14V	probably damaging	Het
Sv2c	T	A	13: 95,986,018	I417F	possibly damaging	Het
Tas2r113	T	A	6: 132,893,516	M169K	probably benign	Het
Tln2	C	T	9: 67,395,461	R76Q	probably damaging	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Tspan18	A	T	2: 93,312,030		probably null	Het
Txndc11	C	T	16: 11,084,314	V679I	probably damaging	Het
Usf1	G	T	1: 171,416,964	G144V	possibly damaging	Het
Vmn1r59	T	C	7: 5,454,452	Y103C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,826	I713F	probably damaging	Het
Vmn2r79	A	T	7: 87,037,960	I850F	probably damaging	Het
Wdr90	C	T	17: 25,855,363	R676H	probably benign	Het
Zfp867	G	A	11: 59,463,661	R281W	probably damaging	Het
Zfp939	T	C	7: 39,472,942		noncoding transcript	Het

Other mutations in Tgm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02206:Tgm1	APN	14	55704935	missense	possibly damaging	0.92
IGL02934:Tgm1	APN	14	55709989	missense	probably damaging	1.00
IGL03243:Tgm1	APN	14	55705907	missense	probably damaging	0.98
IGL03282:Tgm1	APN	14	55711070	missense	probably damaging	1.00
PIT4458001:Tgm1	UTSW	14	55712565	missense	unknown
R0277:Tgm1	UTSW	14	55710927	unclassified	probably benign
R0277:Tgm1	UTSW	14	55712652	unclassified	probably benign
R0478:Tgm1	UTSW	14	55700334	nonsense	probably null
R1349:Tgm1	UTSW	14	55711201	unclassified	probably benign
R1594:Tgm1	UTSW	14	55709519	missense	probably damaging	0.96
R1776:Tgm1	UTSW	14	55709397	missense	probably damaging	0.99
R1852:Tgm1	UTSW	14	55704941	missense	probably damaging	1.00
R1988:Tgm1	UTSW	14	55705577	missense	probably benign	0.00
R2064:Tgm1	UTSW	14	55709471	missense	probably damaging	1.00
R2139:Tgm1	UTSW	14	55709543	missense	probably damaging	1.00
R2427:Tgm1	UTSW	14	55712100	critical splice donor site	probably null
R3710:Tgm1	UTSW	14	55712595	unclassified	probably benign
R3917:Tgm1	UTSW	14	55712757	splice site	probably benign
R4804:Tgm1	UTSW	14	55705619	missense	probably benign	0.38
R5074:Tgm1	UTSW	14	55709935	missense	probably damaging	1.00
R5341:Tgm1	UTSW	14	55700248	missense	possibly damaging	0.90
R5346:Tgm1	UTSW	14	55711172	missense	probably damaging	0.99
R5557:Tgm1	UTSW	14	55705643	missense	probably benign	0.10
R5566:Tgm1	UTSW	14	55712436	missense	probably damaging	0.99
R5828:Tgm1	UTSW	14	55705554	missense	probably benign	0.38
R6802:Tgm1	UTSW	14	55712482	unclassified	probably benign
R7017:Tgm1	UTSW	14	55704941	missense	possibly damaging	0.76
R7094:Tgm1	UTSW	14	55704843	missense	possibly damaging	0.53
R7549:Tgm1	UTSW	14	55705903	missense	probably benign	0.02
R7731:Tgm1	UTSW	14	55710521	missense	probably benign	0.21
R7799:Tgm1	UTSW	14	55712475	missense	unknown
R7915:Tgm1	UTSW	14	55700426	missense	probably damaging	0.98
R7956:Tgm1	UTSW	14	55708895	missense	probably benign	0.01
R8098:Tgm1	UTSW	14	55710534	missense	probably damaging	1.00
R8190:Tgm1	UTSW	14	55704884	missense	probably damaging	1.00
R8423:Tgm1	UTSW	14	55705643	missense	probably benign	0.35
R8493:Tgm1	UTSW	14	55700297	missense	probably damaging	1.00
R8859:Tgm1	UTSW	14	55712229	missense	probably benign	0.01
R9170:Tgm1	UTSW	14	55708898	missense	probably damaging	1.00
R9300:Tgm1	UTSW	14	55704846	missense	probably benign	0.05
R9365:Tgm1	UTSW	14	55704892	missense	probably damaging	0.96
R9407:Tgm1	UTSW	14	55705534	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGAGACACCAGTGTAGTAGG -3'
(R):5'- CATTGTCACAAAGGCGATCCAC -3'

Sequencing Primer
(F):5'- CACCAGTGTAGTAGGTGACAC -3'
(R):5'- GATCCACTCCAACAATCGAGAGG -3'

Posted On

2015-10-21