Incidental Mutation 'R4697:Ccdc74a'
ID 355800
Institutional Source Beutler Lab
Gene Symbol Ccdc74a
Ensembl Gene ENSMUSG00000041617
Gene Name coiled-coil domain containing 74A
Synonyms 2310015A05Rik
MMRRC Submission 041947-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R4697 (G1)
Quality Score 194
Status Validated
Chromosome 16
Chromosomal Location 17464340-17468602 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17467613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 184 (S184P)
Ref Sequence ENSEMBL: ENSMUSP00000049541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006053] [ENSMUST00000012259] [ENSMUST00000056962] [ENSMUST00000080936] [ENSMUST00000090159] [ENSMUST00000163476] [ENSMUST00000232236] [ENSMUST00000232645] [ENSMUST00000182368] [ENSMUST00000182344] [ENSMUST00000182117]
AlphaFold E9Q9U8
Predicted Effect probably benign
Transcript: ENSMUST00000006053
SMART Domains Protein: ENSMUSP00000006053
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 768 N/A PFAM
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000012259
SMART Domains Protein: ENSMUSP00000012259
Gene: ENSMUSG00000012114

DomainStartEndE-ValueType
Pfam:Med15 17 789 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056962
AA Change: S184P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049541
Gene: ENSMUSG00000041617
AA Change: S184P

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 50 105 4.1e-24 PFAM
low complexity region 154 164 N/A INTRINSIC
Pfam:CCDC74_C 209 326 1.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080936
SMART Domains Protein: ENSMUSP00000079737
Gene: ENSMUSG00000012114

DomainStartEndE-ValueType
Pfam:Med15 17 749 1.2e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090159
SMART Domains Protein: ENSMUSP00000087620
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.4e-177 PFAM
Pfam:mit_SMPDase 287 752 9.4e-259 PFAM
transmembrane domain 753 775 N/A INTRINSIC
transmembrane domain 782 799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163476
SMART Domains Protein: ENSMUSP00000131867
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 739 9.8e-266 PFAM
transmembrane domain 740 762 N/A INTRINSIC
transmembrane domain 769 786 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183101
Predicted Effect probably benign
Transcript: ENSMUST00000232236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232012
Predicted Effect probably benign
Transcript: ENSMUST00000232645
Predicted Effect probably benign
Transcript: ENSMUST00000182368
SMART Domains Protein: ENSMUSP00000138262
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 49 110 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232417
Predicted Effect probably benign
Transcript: ENSMUST00000182344
SMART Domains Protein: ENSMUSP00000138131
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
Pfam:CCDC92 18 79 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231480
Predicted Effect probably benign
Transcript: ENSMUST00000182976
Predicted Effect probably benign
Transcript: ENSMUST00000182117
SMART Domains Protein: ENSMUSP00000138657
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Pfam:CCDC92 36 97 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183279
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,615,243 (GRCm39) M1T probably null Het
Aatf T A 11: 84,339,964 (GRCm39) D449V probably damaging Het
Acbd3 T A 1: 180,549,509 (GRCm39) probably benign Het
Bicc1 T A 10: 70,789,314 (GRCm39) I366F possibly damaging Het
Cntn4 T C 6: 106,502,446 (GRCm39) V401A probably damaging Het
Cux2 T C 5: 122,011,816 (GRCm39) T540A probably damaging Het
Disp2 G T 2: 118,622,165 (GRCm39) E966* probably null Het
Dpp7 A G 2: 25,244,931 (GRCm39) Y209H probably benign Het
Dstyk T A 1: 132,377,225 (GRCm39) F277Y probably damaging Het
Dtx1 A T 5: 120,832,473 (GRCm39) probably null Het
Ear-ps2 G A 14: 44,284,517 (GRCm39) noncoding transcript Het
Ednra T C 8: 78,391,624 (GRCm39) H422R probably benign Het
Erlec1 T A 11: 30,902,640 (GRCm39) I67F probably benign Het
Fam161b G A 12: 84,395,332 (GRCm39) probably benign Het
Gata5 A T 2: 179,969,172 (GRCm39) C345* probably null Het
Glmp T C 3: 88,235,581 (GRCm39) V47A probably damaging Het
Gm9762 T A 3: 78,873,857 (GRCm39) noncoding transcript Het
Gnas A T 2: 174,139,873 (GRCm39) D14V probably damaging Het
Gnl3 T C 14: 30,739,286 (GRCm39) S53G probably damaging Het
Grhl3 C T 4: 135,275,777 (GRCm39) V527M probably damaging Het
Hoxd10 T A 2: 74,524,531 (GRCm39) L281* probably null Het
Kif16b T G 2: 142,532,614 (GRCm39) Y1175S probably benign Het
Kif2b A G 11: 91,467,672 (GRCm39) S204P probably benign Het
Klhl40 T A 9: 121,607,800 (GRCm39) I320N probably damaging Het
Ksr2 G A 5: 117,846,212 (GRCm39) R693Q probably damaging Het
Mis12 A G 11: 70,916,152 (GRCm39) K62E possibly damaging Het
Mlc1 A G 15: 88,858,980 (GRCm39) C102R probably damaging Het
Muc5b T C 7: 141,411,098 (GRCm39) I1348T unknown Het
Myh7b A G 2: 155,471,242 (GRCm39) E1130G probably damaging Het
Nat8f4 T C 6: 85,878,368 (GRCm39) T52A probably benign Het
Nxpe2 C A 9: 48,231,821 (GRCm39) V379L probably benign Het
Or10ad1c G A 15: 98,084,749 (GRCm39) R310W probably damaging Het
Or4c1 T A 2: 89,133,247 (GRCm39) S230C probably damaging Het
Or4c1 C A 2: 89,133,246 (GRCm39) S230I possibly damaging Het
Or5b111 A T 19: 13,291,081 (GRCm39) D189E probably benign Het
Or5b12 C T 19: 12,897,298 (GRCm39) C125Y probably damaging Het
Pcdhga7 A T 18: 37,850,261 (GRCm39) Y756F probably damaging Het
Pcsk6 T A 7: 65,608,989 (GRCm39) Y284N probably damaging Het
Pdcd11 T C 19: 47,114,786 (GRCm39) V1367A possibly damaging Het
Postn T A 3: 54,282,492 (GRCm39) N484K probably damaging Het
Prkd3 C T 17: 79,268,600 (GRCm39) V572I probably benign Het
Qser1 T C 2: 104,617,528 (GRCm39) S1005G probably benign Het
Radil G T 5: 142,472,556 (GRCm39) D951E probably benign Het
Ripk1 C T 13: 34,211,925 (GRCm39) R352* probably null Het
Sacs T C 14: 61,450,196 (GRCm39) F4081L probably benign Het
Sbf1 A G 15: 89,199,288 (GRCm39) V11A possibly damaging Het
Sgip1 T A 4: 102,791,784 (GRCm39) F536I probably damaging Het
Slc45a1 A G 4: 150,722,741 (GRCm39) L381P probably damaging Het
Smarcad1 C T 6: 65,029,625 (GRCm39) P71L probably benign Het
Spns1 T A 7: 125,976,209 (GRCm39) D14V probably damaging Het
Sv2c T A 13: 96,122,526 (GRCm39) I417F possibly damaging Het
Tas2r113 T A 6: 132,870,479 (GRCm39) M169K probably benign Het
Tgm1 A T 14: 55,943,138 (GRCm39) N567K probably benign Het
Thoc2l A G 5: 104,670,106 (GRCm39) K1543E probably benign Het
Tln2 C T 9: 67,302,743 (GRCm39) R76Q probably damaging Het
Trpm6 T C 19: 18,831,155 (GRCm39) V1340A probably benign Het
Tspan18 A T 2: 93,142,375 (GRCm39) probably null Het
Txndc11 C T 16: 10,902,178 (GRCm39) V679I probably damaging Het
Usf1 G T 1: 171,244,532 (GRCm39) G144V possibly damaging Het
Vmn1r59 T C 7: 5,457,451 (GRCm39) Y103C probably damaging Het
Vmn2r23 A T 6: 123,718,785 (GRCm39) I713F probably damaging Het
Vmn2r79 A T 7: 86,687,168 (GRCm39) I850F probably damaging Het
Vps35l T A 7: 118,390,671 (GRCm39) I455N probably damaging Het
Wdr90 C T 17: 26,074,337 (GRCm39) R676H probably benign Het
Zfp867 G A 11: 59,354,487 (GRCm39) R281W probably damaging Het
Zfp939 T C 7: 39,122,366 (GRCm39) noncoding transcript Het
Other mutations in Ccdc74a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ccdc74a APN 16 17,467,661 (GRCm39) missense possibly damaging 0.51
IGL01549:Ccdc74a APN 16 17,468,406 (GRCm39) missense probably benign
IGL03144:Ccdc74a APN 16 17,466,730 (GRCm39) missense possibly damaging 0.70
R0390:Ccdc74a UTSW 16 17,468,340 (GRCm39) missense probably benign 0.32
R1756:Ccdc74a UTSW 16 17,468,332 (GRCm39) missense possibly damaging 0.51
R2062:Ccdc74a UTSW 16 17,467,890 (GRCm39) missense probably benign 0.00
R4864:Ccdc74a UTSW 16 17,466,736 (GRCm39) missense probably benign 0.00
R6074:Ccdc74a UTSW 16 17,464,591 (GRCm39) nonsense probably null
R6341:Ccdc74a UTSW 16 17,465,978 (GRCm39) missense probably damaging 0.99
R6404:Ccdc74a UTSW 16 17,467,889 (GRCm39) missense possibly damaging 0.95
R7843:Ccdc74a UTSW 16 17,464,613 (GRCm39) missense
R7943:Ccdc74a UTSW 16 17,468,416 (GRCm39) missense probably benign
R9175:Ccdc74a UTSW 16 17,468,042 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAATTCCAGGAACTACTCTG -3'
(R):5'- CATTCAGGGTCATGTGCCTG -3'

Sequencing Primer
(F):5'- TTCCAGGAACTACTCTGGGCAAG -3'
(R):5'- GTCATGTGCCTGCCCAG -3'
Posted On 2015-10-21