Incidental Mutation 'R4698:Zbtb10'
ID355815
Institutional Source Beutler Lab
Gene Symbol Zbtb10
Ensembl Gene ENSMUSG00000069114
Gene Namezinc finger and BTB domain containing 10
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R4698 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location9250602-9285333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9264550 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 323 (S323P)
Ref Sequence ENSEMBL: ENSMUSP00000119386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000155203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000155203
AA Change: S323P

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119386
Gene: ENSMUSG00000069114
AA Change: S323P

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 38 54 N/A INTRINSIC
low complexity region 75 82 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 180 222 N/A INTRINSIC
ZnF_TTF 239 321 7.92e-2 SMART
BTB 357 456 4.02e-20 SMART
internal_repeat_1 648 671 2.82e-12 PROSPERO
internal_repeat_1 672 695 2.82e-12 PROSPERO
ZnF_C2H2 714 736 6.78e-3 SMART
ZnF_C2H2 742 764 2.09e-3 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,038,240 V11A possibly damaging Het
6030452D12Rik T C 8: 106,504,347 I55T unknown Het
Aadacl2 A G 3: 60,025,039 D325G probably benign Het
Adh1 A G 3: 138,282,513 S113G probably benign Het
Agxt2 T C 15: 10,392,044 probably null Het
Aicda C T 6: 122,553,888 probably benign Het
Aifm2 T C 10: 61,727,756 M135T probably benign Het
Asah2 T C 19: 32,054,471 probably null Het
Btbd17 T C 11: 114,791,717 R390G probably damaging Het
Cadps T C 14: 12,705,654 E247G possibly damaging Het
Cds2 T C 2: 132,304,953 I383T probably damaging Het
Celf3 T A 3: 94,484,867 probably null Het
Crhr2 T C 6: 55,102,867 S162G possibly damaging Het
Dapl1 A T 2: 59,504,774 K91* probably null Het
Ddx60 A C 8: 62,012,424 M1372L probably benign Het
Dnah2 A T 11: 69,498,532 F845I probably damaging Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Ech1 T C 7: 28,832,053 V310A probably benign Het
Eef1g A G 19: 8,977,966 D393G possibly damaging Het
Eif3k T C 7: 28,972,544 I172V possibly damaging Het
Foxd4 A G 19: 24,900,261 F192L probably damaging Het
Gpr153 T A 4: 152,281,783 S268R probably damaging Het
Hist2h3b C A 3: 96,269,078 R129S probably damaging Het
Ivl T C 3: 92,571,391 K456E unknown Het
Kif20b A T 19: 34,951,544 D1190V probably damaging Het
Kif21a T A 15: 90,956,305 I1223L possibly damaging Het
Lmf1 T C 17: 25,579,350 V55A probably damaging Het
Loxhd1 A G 18: 77,372,291 E659G possibly damaging Het
Lrrc37a T C 11: 103,504,104 E165G possibly damaging Het
Mios T C 6: 8,228,113 Y677H possibly damaging Het
Mnx1 T A 5: 29,474,059 K342M unknown Het
Mtpap A T 18: 4,375,724 T35S possibly damaging Het
Ndc1 C G 4: 107,411,137 D623E probably benign Het
Nedd4l A G 18: 65,203,880 Y666C probably damaging Het
Olfr1022 A G 2: 85,869,252 Y220C possibly damaging Het
Olfr1445 T G 19: 12,884,621 F247V probably benign Het
Olfr204 T C 16: 59,315,357 T17A probably damaging Het
Olfr605 T A 7: 103,442,635 I163F possibly damaging Het
Papss1 G T 3: 131,607,331 V369F probably damaging Het
Pcdhac2 T A 18: 37,145,769 Y601N probably damaging Het
Pde7a C T 3: 19,310,931 R24Q probably damaging Het
Phf21a A G 2: 92,356,952 D445G probably damaging Het
Plekho1 T A 3: 95,995,652 N15I possibly damaging Het
Pprc1 T C 19: 46,069,195 probably benign Het
Ralgapa1 A T 12: 55,677,276 probably null Het
Rrp12 T C 19: 41,873,042 E942G probably benign Het
Skor1 T C 9: 63,144,548 D685G probably benign Het
Smim23 A T 11: 32,824,510 I3N possibly damaging Het
Spata7 A T 12: 98,664,277 I333F probably damaging Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Srgap1 C A 10: 121,792,487 R837L probably benign Het
Stpg2 C A 3: 139,309,229 P385H probably damaging Het
Tmem238 C A 7: 4,789,017 E19* probably null Het
Top2b A T 14: 16,387,331 K140* probably null Het
Trp53 T A 11: 69,588,422 L142* probably null Het
Tyro3 A T 2: 119,803,270 D133V probably damaging Het
Virma T A 4: 11,528,636 I1291N probably damaging Het
Vmn1r213 A G 13: 23,011,337 probably benign Het
Zfp521 A T 18: 13,845,603 N584K probably damaging Het
Zfp944 A G 17: 22,339,199 C356R probably damaging Het
Other mutations in Zbtb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02174:Zbtb10 APN 3 9251812 missense probably damaging 0.96
IGL02207:Zbtb10 APN 3 9280465 critical splice donor site probably null
IGL02499:Zbtb10 APN 3 9251740 missense probably damaging 1.00
IGL02506:Zbtb10 APN 3 9265237 missense probably damaging 0.99
IGL03294:Zbtb10 APN 3 9280987 missense probably benign 0.18
R0510:Zbtb10 UTSW 3 9264668 missense probably damaging 1.00
R1859:Zbtb10 UTSW 3 9280386 missense possibly damaging 0.47
R2342:Zbtb10 UTSW 3 9265195 missense possibly damaging 0.60
R3407:Zbtb10 UTSW 3 9264866 missense probably damaging 1.00
R4161:Zbtb10 UTSW 3 9280296 missense probably damaging 1.00
R4301:Zbtb10 UTSW 3 9265160 missense probably damaging 0.96
R5184:Zbtb10 UTSW 3 9264671 missense probably damaging 0.99
R5443:Zbtb10 UTSW 3 9280048 missense probably benign
R5665:Zbtb10 UTSW 3 9265192 missense probably damaging 0.99
R5744:Zbtb10 UTSW 3 9264563 missense probably damaging 1.00
R5862:Zbtb10 UTSW 3 9265216 missense probably damaging 0.98
R5909:Zbtb10 UTSW 3 9280049 missense probably benign 0.14
R6547:Zbtb10 UTSW 3 9251703 missense probably benign 0.38
R6612:Zbtb10 UTSW 3 9252065 missense possibly damaging 0.87
R7457:Zbtb10 UTSW 3 9251478 missense possibly damaging 0.77
Z1177:Zbtb10 UTSW 3 9278331 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCCAGCCTTGATAGACTTC -3'
(R):5'- AACTGCAGCAATATCTAAGTGGGTAG -3'

Sequencing Primer
(F):5'- CCAGCCTTGATAGACTTCTTTTGGAG -3'
(R):5'- GTCTTAAAGAAACGGCTGCCTGC -3'
Posted On2015-10-21